GRF4, GRF4 (gene) Malus x domestica

Gene Overview
Name GRF4
Gene Symbol GRF4
Type gene
Organism Malus x domestica
Synonym GRF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GRF4HM122564.1-GRF4.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Growth regulating factorGRFMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122564.1-GRF4.m1 Chr00:238724..244578
unanchored:10846509..10852363
HM122564.1

Sequence(s):
>HM122564.1-GRF4.m1981
atgagcgggtcgtcggtgggcaatgaaggtcacgcgccgctcttcacagtggcgcaatgggctgagatggagaatcaagc
tttgatattcaagtatctcaaggcaggactccctgttccttctgaactcctcgcccctattcgcaccagtttcaatctca
tttcccccaatttcttacgccaccaccccaccttggcttcctatagccggaagaagatggacccggagccagggcggtgc
cggaggacggatggcaagaaatggaggtgctccaaagatgcacatccggagtccaagtattgcgagcggcacatgaaccg
aggccgttatcgttcaagaaagcttgtggaatcacaaacttcctctcaatctttgtcgactgtgacgtcagacagtgtga
ttgggatctgcagccacagtgggagcttccagagcatgcccttacactcaatgggaaatagtggagctctatgctttgga
agcaatgcatctgagttgaagatggagagtataccatatggggtatctaacaggggaaccaggggctgcaatggatcaga
agaacataatttcgtgtcagaagctaggagtgcgaggtgtcttcgggcagacagtaatgtagataatccgtggcttctaa
tggcgcctcaagttcccttgaaattagaaccgagaaatagttctctttggctaaacaacagctctcatctacagacatta
caaaatatggagccattgagcgttaatgctgaaatcaccaaacatgagtatgttggtgaagagtttggcttaccaggatc
tcaaaaacacgaacagcattctcttcaacctttctttgacgagtggcctaagtcaaaggatctggggttccatcaaaatg
atcatagatcaaacataactgaattgtcaatgtctaatgcaacggttcctgctaaatttttcctaaggagcgctgaatca
ccccgtgatgcctatacttga
back to top