IPT1B, IPT1B (gene) Malus x domestica

Gene Overview
Name IPT1B
Gene Symbol IPT1B
Type gene
Organism Malus x domestica
Synonym adenylate isopentenyltransferase
Description NA
Comment cytokinin biosynthesis enzyme
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT1BHQ585952.1-IPT1B.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HQ585952.1-IPT1B.m1 Chr16:2935617..2936730
chr16:1116898..1118011
chr16:1116899..1118012
HQ585952.1

Sequence(s):
>HQ585952.1-IPT1B.m11113
atgacacttcatcccttcccaactcactccctccattattccaatttcaatttcaatacgaattatatctcccaccgttt
ccacttgctcccgcagctccaccacctctacaaccaccccactcatccgcttcacctcccccaaaggccccgccgctggg
cccacatggccaccggccacacttccgcggtcccacgtcgaaaagacaagctcctcgtcatcatgggggccactggcgcc
ggcaagtcccgcctctccctcgacctcgccacccgcttccccttcttcgaaatcatcaactccgacaaaatacaactcta
ccgcggcctcgacatcaccaccaacaagctccccctcccggaacgactcggcgttccccaccacctcctcggcgagttgg
acccccgagacggagatttcacgcccgccgattttcgcgccgtcgccggtcaggttgtttccggcattacgaatcggagg
aaggtgccgatgctcgtcggcgggtcaaactccttcattcacgcgatggtcgcggaccgtttcgaaccggggtgcaatgt
cttcgaaccgggttcagacgcctccctctcggccgagctcagatacaattgctgttttctgtgggtggacgtgtcgatgg
cggtgttgacagagtatctatcgaagcgagtcgacgaaatgctcgactcgggaatgttcgaggagttggccgagttttgc
gacccggatcgccaggacaagcacgacccggcagcggttccgaccgggctgagaaaggcgattggagtgcccgagttcac
tcggtattttaaaaaatacccacaaagtaaaagggacgaggacgatgatcgggagcggagaggagcatacgaagaggcgg
taagggcgatcaaggacaacacgtgtcagctggcgaagaggcagatagggaaggtcctacgtttgagagggggagggtgg
gacctacggagactagacgcaacggacgcgtttagggcggtggttgcgacgacatcgtcggatagtgacggcggagagag
gtggtcagatatatgggagagacaggtggtgggaccaagcgtgaagattgtgaagcgcttcttggaggagtag
back to top