IPT1A, IPT1A (gene) Malus x domestica

Gene Overview
Name IPT1A
Gene Symbol IPT1A
Type gene
Organism Malus x domestica
Synonym adenylate isopentenyltransferase
Description NA
Comment cytokinin biosynthesis enzyme
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT1AHQ585951.1-IPT1A.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HQ585951.1-IPT1A.m1 Chr13:2775657..2776770
chr13:2401773..2402886
chr13:2411044..2412157
chr13:2388066..2389179
HQ585951.1

Sequence(s):
>HQ585951.1-IPT1A.m11113
atgacacttcatgccttcccaactcactccctccattattctaatctcaatttcaatacgaattatatcttccaccgctt
caacttgttcccgccgctccaccacctctacaaccaccccactcctccgcttcacctcccccaaaggccccgccgctcgg
cccacatggccaccggccccacctccgctggcccacgaagaaaagacaagcttctcgtcatcatgggggccaccggcgct
ggcaagtcccgcctctccctcgacctcgccagccgcttccccttcttcgaaatcgtcaactccgacaaaatacaactcta
ccgcggcctagacatcaccaccaacaagctccccctaccggaacgactcggcgtcccccaccacctcctcggcgagttcg
accccctagacggcgacttcacccccgccgattttcgcgccgtcgccggtcaggttgtttccggcattaccaatcggagg
aaggtgccgatgctcgtaggcgggtcaaactccttcattcacgcgatggtcgcggaacggttcgaaccgggctccaatgt
cttcgaaccgggtttcgacgcctccgtctcggccgagctcaggtacaattgctgttttctttgggtggacgtgtcgatgg
cggtgttgacggagtatttatcaaagcgagtcgacgaaatgctcgactcgggaatgttcgacgagttggcagagttttgc
gacccggatcgccaggacaagaaggacccagctgcggttccgacagggttgagaaaggcgattggagtgcccgagttcac
tcggtattttaaaaaatacccacaaagtaaaagagacgaggacgacgaccgggagcggagaggagcatacgaagaggcgg
tgagggtgatcaaggacaacacgtgtcagctggcgaagaggcagatagggaagatcctacggttaagagggggagggtgg
gacttacggagactagacgcaacggacgcgtttagggcggtggttgcgacgtcgacgccggaaaatgacggcggagagag
gtggtcagagatatgggagcggcaggtggtggaaccaagcgcgaagattgtgaagcgcttcttggaggagtag
back to top