IPT3A, IPT3A (gene) Malus x domestica

Gene Overview
Name IPT3A
Gene Symbol IPT3A
Type gene
Organism Malus x domestica
Synonym adenylate isopentenyltransferase
Description NA
Comment cytokinin biosynthesis enzyme
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT3AHQ585947.1-IPT3A.m1Malus x domesticamRNA
IPT3AHQ606061.1-IPT3A.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HQ585947.1-IPT3A.m1 Chr03:35283548..35284511
chr3:31482981..31483944
chr3:37001354..37002317
HQ585947.1
predicted genes from whole genome assembly HQ606061.1-IPT3A.m1 Chr03:35283548..35284511
chr3:31482981..31483944
chr3:37001354..37002317
HQ606061.1

Sequence(s):
>HQ585947.1-IPT3A.m1963
atgatgccaatgtgcaaacaaatacaaacattactacatgttccatctagtggccataatcataaaatggacgtgttcaa
tcctcaccggcagaaggagaaggtggtgatcgtaatgggagcaacagggaccggaaagtcaaggctctccatcgacctag
ccacctgtttcccggcagaaatcataaactccgacaaaatgcaagtctacgaaggccttgacatagtcaccaacaaaata
accaaagaagagcaacgtggtgtaccgcaccatttgctagggatgctagatcctcatgaagattttactgccagggattt
ttgtgacctaacctcaattgccattgaatccattttaggccgtgatcggcttccaatcatcgttggaggttccaactctt
acatcgaggcgttgatcgatgattatgactataaatttcggtccaagtatgactgttgctttttatgggtagatgtgtct
acacccgttctgcactcttttgtgtcaaaacgggtagaccacatggttcaaaacggaatggtggatgaggcgagagagta
ctttgatcccaatgcagattacacgaaagggattcgaagagcaataggggtccctgaattcgataagtacttcaggtatg
ggccatttttggaagaagaaactcgtgctcggttactacgacaagcagtggacgaaattaaggacaatacgtgcaaattg
gcatgtcgacaactggagaagattcatagacttagaaatatcaaagggtggaatctgcacccgttggatgccacggaggt
gttccgaaagcgcggcgaagaggccgacgaggcctggaaaaagcttgtgtcggggacaagtgctatgatcgttggccagt
ttctttacaatatgacagctgaggttcctccacatcttggaagccttagggttcttgaagcacttgcagctgcaactcac
tag
back to top
>HQ606061.1-IPT3A.m1963
atgatgccaatgtgcaaacaaatacaaacattacaacatgttccatctagtggccataatcataaaatcgacgtgttcaa
tcctcaccggcagaaggagaaggtggtgatcgtaatgggagcaacagggaccggaaagtcaaggctctccatcgacctag
ccacctgtttcccggcagaaatcataaactccgacaaaatgcaagtctacgaaggccttgacatagtcaccaacaaaata
accaaagaagagcaacgtggtgtaccgcaccatttgctagggatgctagatcctcatgaagattttactgccagggattt
ttgtgacctaacctcaattgccattgaatccattttaggccgtgatcggcttccaatcatcgttggaggttccaactctt
acatcgaggcgttgatcgatgattatgactataaatttcggtccaagtatgactgttgctttttatgggtagatgtgtct
acacccgttctgcactcttttgtgtcaaaacgggtagaccacatggttcacaacggaatggtggatgaggcgagagagta
ctttgatcccaatgcagattacacgaaagggattcgaagagcaataggggtccctgaattcgataagtacttcaggtatg
ggccatttttggatgaagaaactcgtactcggttactacgacaagcagtggacgaaattaaggacaatacgtgcaaattg
gcatgtcgacaactggagaagattcatagacttagaaatatcaaagggtggaatctgcacccgttggatgccacggaggt
gttccgaaagcgcggcgaagaggccgacgaggcctggaaaaagcttgtgtcggggacaagtgctatgatcgttggccagt
ttctttacaatatgacagctgaggttcctccacatcttggaagccttagggttcttgaagcacttgcagctgcaactcac
tag
back to top