IPT5, IPT5 (gene) Rosa hybrid cultivar

Gene Overview
Name IPT5
Gene Symbol IPT5
Type gene
Organism Rosa hybrid cultivar
Synonym IPT5
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT5KJ933390.1-IPT5.m1Rosa hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTRosa hybrid cultivargene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KJ933390.1-IPT5.m1 N/A KJ933390.1

Sequence(s):
>KJ933390.1-IPT5.m1743
actcgaacttcactgctactgatttcaagcatcatgcttctttggccattgaatcgatattggagcgtgaccggttaccg
atcatcgccggtgggtcaaactcttacatagaggcactggtggacgagcacgccgagttccggaggaggtacgagtgttg
ctttctgtgggtggacgtggcgccgcgtgtgctcaactcgtttgtgtcggagcgagttgatcggatggtggaggtgggtg
gtctggtggacgaggtgaggagaatgttcgacccaacagccgacgaggaggactatagcaccgggattaagaaagctatc
ggagttccagagatgcatcattacttgcgcggcgaagcgtgtggcaacgatgaagagactcaagaagcgctgttgatgga
agctatttcgaacatcaagaagaatactcgcacgttggcccatcgccaactgcaaaagattcaccggctgcggagcaagt
ggaactggagcatgcaccgcctcgacgccaccgaagctttcttgaaccgccgtcgaggccgggagggagaccgagtgtgg
gagaagcaagttgcgagacccgccacagtaatcgtcagaaagttcctcgtagacccaatgtcaaccattcttcctcatga
cactgcctttgtagctgcagcggctacggccggcagcaccagcaccaccagtgtcaattctcttgcggtgtccatgccgg
ccgtggctgctgcaacacggtag
back to top