IPT7A, IPT7A (gene) Malus x domestica

Gene Overview
Name IPT7A
Gene Symbol IPT7A
Type gene
Organism Malus x domestica
Synonym adenylate isopentenyltransferase
Description NA
Comment cytokinin biosynthesis enzyme
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT7AHQ585953.1-IPT7A.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HQ585953.1-IPT7A.m1 Chr00:16949198..16950053
chr6:5106679..5107534
chr6:7224281..7225136
chr6:5896277..5897132
chr6:8409210..8410065
HQ585953.1

Sequence(s):
>HQ585953.1-IPT7A.m1855
atggaacctgtgcatgtcaatggttctgtccacaaaaaggcgaaggttgtttttataatgggtccgactgggtgtggaaa
aaccaaactttccatagacctagctaccaattacgggggagaagtaattaattcggacaaaatccaagtctacaaaggcc
tggacattgtcactaacaaagccacagaatctgagcaacgaggcatccgtcatcacttgctagggttcgtagaagacccc
gtagctgatttctccgttgatgaatttcgtcgtcgtgtgcaaacttcaatcgatgagatcacaaagcgtaactgcctccc
aatcattgctggcggatccaactcttatatcgaggcactcatcgaagatccagtgattgattttcgaaataaatatgatt
gctgttttatatggcttgatgtgtcgttgcctgtgctatataaccatgtgtccaaaagagttgacgaaatggtggctgca
ggattagtggatgagcttcgtgaaatgtttgctccaggggtgaattatgatggtggcattcgccgagcaatcggagctcc
ggagatgcatccgtacttcatggctgaaatgaacaacaatatagtagacgatgacaaggttcgtaaggaatttctgctga
aagatggcatttggaaaaccaaagaaaatacttgtaaacttgctgaacgccaagtgcagaaaattaaacttctcagcgac
aaatgggatattcatcgtattgatgtcactgctgtgtatgagaactgtggaaaggaagctgtggttgcctgggaaacctt
ggttttaaagccaagtttcaccattgtgggtggatttttgaagaaacatggttga
back to top