COX1, EU701209.1-COX1 (gene) Rubus occidentalis

Unique NameEU701209.1-COX1
OrganismRubus occidentalis (Black raspberry)

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
COX1COX1Rubus occidentalisgene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
COX1EU701209.1-COX1.m1Rubus occidentalismRNA

This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
EU701209 region EU701209:1..655+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this gene
The following sequences are available for this feature:

gene sequence

>EU701209.1-COX1 ID=EU701209.1-COX1|Name=COX1|organism=Rubus occidentalis|type=gene|length=655bp
back to top

gene from alignment at EU701209:1..655+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU701209.1-COX1 ID=EU701209.1-COX1|Name=COX1|organism=Rubus occidentalis|type=gene|length=655bp|location=Sequence derived from alignment at EU701209:1..655+ (Rubus occidentalis)
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgg gcacatgcttctcagtactgattcgtatggaattagcacgacccggcgat caaattcttggtgggaatcatcaactttataatgttttaataacggctca cgcttttttaatgatcttttttatggttatgccggcgatgataggtggat ttggtaattggtttgttccgattctgataggtgcacctgacatggcattt ccacgattaaataatatttcattctggttgttgccaccaagtctcttgct cctattaagctccgccttagtagaagtgggtagcgggactgggtggacgg tctatccgcccttaagtggtattaccagccattctggaggagctgttgat ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttc tatcaattttataacaactatcttcaacatgcgtggacctggaatgacta tgcatagattacccctatttgtgtggtccgttctagtgacagcattccta cttttattatcacttcccgtactggcaggggcaattaccatgttattaac cgatcgaaactttaatacaaccttttttgatcccgctggggggggagacc ccata
back to top