LFY, EU683932.1-LFY (gene) Crataegus submollis

Unique NameEU683932.1-LFY
OrganismCrataegus submollis ()

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus submollisgene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU683932.1-LFY.m1Crataegus submollismRNA

This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
EU683932 region EU683932:1..1052+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this gene
The following sequences are available for this feature:

gene sequence

>EU683932.1-LFY ID=EU683932.1-LFY|Name=LFY|organism=Crataegus submollis|type=gene|length=1052bp
back to top

gene from alignment at EU683932:1..1052+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU683932.1-LFY ID=EU683932.1-LFY|Name=LFY|organism=Crataegus submollis|type=gene|length=1052bp|location=Sequence derived from alignment at EU683932:1..1052+ (Crataegus submollis)
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggtta tactttgcggccgccaagggagcttggacttggagggcttgaagacttgt tccaggcttatggggttagatactacacggcggcgaagatagcggagctt ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag gaggaggactctcggcggcgcaaccttgtctctggtgataccaccaccaa tgccctagatgctctctcccaagaaggtactattcgctatattatataca tgaatattatttacccttatgtcttagattaaccgtagtatataggcata taggtagggtttgattacactttgaaataacattattttatatgtaaatt aatagtgtgacaatataacatgttcaaacagaaaaaagaattagaattta gtgaatcaaagaagaaaaataggtcgcaaaacattaaaacttttggcctt tggtgtaataatttgatggaaataacaaatcaaagatgtttattattttg tgacatactatgccagatcataagatgttcgagattgcgtgataaaacta aaagcatatgttttatatgattgtaacataatatgtcaattatcgtagtc tttgatactagaacataaagtagttgttatattagattgggatatatgac acgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaaga gaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacgg cgggggagaggcggaagaagcagcggaggatgaagaaggggcaatatagg aactgtagtgctggagggggtcataataatgatcataacgagggtgtaga cgacaaggacgacgacatggacgacatgaatgggcaggggaacggtggag ga
back to top