LFY, EU050741.1-LFY (gene) Prunus texana

Overview
NameLFY
Unique NameEU050741.1-LFY
Typegene
OrganismPrunus texana ()
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPrunus texanagene


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Alignments
Feature NameTypeLocationAnalysis
EU050741 region EU050741:1..658+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this gene
DatabaseAccession
nuccoreEU050741.1
Sequences
The following sequences are available for this feature:

gene sequence

>EU050741.1-LFY ID=EU050741.1-LFY|Name=LFY|organism=Prunus texana|type=gene|length=658bp
gtacggagtttacccaacctctcgtcttcataacctaaatgcatacgctg
atttatactgtggtaaatagtaaatactaatagtaacttgtcgcatggac
tatcatacctggtcaatgtggtcccatttccgcgagtacaaacaattaca
atctagtggctcgacaggtycaattggaaacacctgctgacaacatcaat
ataatgtttgagctaactctggaccgggtctgaatttttcattgattatg
tggcagagtaagttcacaagaaattttttgaaaaaaaaaagggggtttgt
gaataagatcatattttaatcctacgttggtctgaatttgatctgctttg
ttagaaatatatagtgattccaataatgatgttaatatgacgtagaattg
gataattggttagcttagtgattttcacactcatgttttgttcgtttgca
ctccgcactttgttatattttgatgatctatcatctgcttttatttccca
aggtagaaaaacaatagaaaagtgcaaacsgataaaatcggagtgtgaaa
gtcgccacccttaggtatccgatatttgtaaataatgaatgatttatctt
gtgaccatgacaagtgaattgttgtattttggttgtgtggacatgaatta
ttgtgcag
back to top