GDsnp01351, GDsnp01351 (genetic_marker) Malus domestica

Marker Overview
NameGDsnp01351
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesMalus x domestica
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp01351GDsnp01351Malus x domesticamarker_locus


Sequence
>GDsnp01351 ID=GDsnp01351|Name=GDsnp01351|organism=Malus x domestica|type=genetic_marker|length=201bp
GAAGTCGCTGCTCCTCTTCCACGAACCTCCGCGACTCCGCCACGGCTCTT
GCCGCCACGTGGAGGTTCCTTAGCCGCTCGATGTTTGGGTTCGACGATGA
SGATCGGACGGTCTGTGATCGAGGTACGAGGAGGACCCGCTCTTTTGAAT
ACACAAGCTCATTGGACGACGGGTCCCTGTGTGTGGACCTCACGGACATC
A
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A8.4GDsnp01351View
2Apple-FjxPL-F1-2013LG1N/A14.84GDsnp01351View