GDsnp00697, GDsnp00697 (genetic_marker) Malus domestica

Marker Overview
NameGDsnp00697
AliasGD_SNP00697
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesMalus x domestica
Publication[view all]
ContactCindy F. Verdu
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp00697GDsnp00697Malus x domesticamarker_locus


Sequence
>GDsnp00697 ID=GDsnp00697|Name=GDsnp00697|organism=Malus x domestica|type=genetic_marker|length=201bp
TGACAGGCATGAAACCAGCGGCAGGATGATCTGGCCCTTCTGCTCCAATT
GCAGGCCCAGCATCAACCTGCCTAGTTGTGGAAGAAGAGGATTGGCAGCA
MGCTAACTTGGGAGCTCTTTTGGCATCCTCTTGGACGAAACAACGATTAG
CTGCTCTCTGCCACACAGCCCTTGCTTCTGCTGCTGCCATCAACTTGCTA
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A19.6GDsnp00697View
2Apple-FjxPL-F1-2013LG1N/A37.48GDsnp00697View
Contact
NameDetails
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com