GDsnp00252, GDsnp00252 (genetic_marker) Malus domestica

Marker Overview
NameGDsnp00252
AliasGD_SNP00252_FM
GD_SNP00252
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
5' Flanking SequenceAAACTCTCTCCGTGTTTCCCATGAA
3' Flanking SequenceGGTATGCAGCGTGCTGCAGCATCCGAAGTTAGA
SpeciesMalus x domestica
Publication[view all]
ContactCindy F. Verdu
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
procyanidin B2 contentqPCB.X5210X8402-LG1.J10Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.procyanidinEbMalus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp00252GDsnp00252Malus x domesticamarker_locus
GD_SNP00252GD_SNP00252Malus x domesticamarker_locus


Sequence
>GDsnp00252 ID=GDsnp00252|Name=GDsnp00252|organism=Malus x domestica|type=genetic_marker|length=201bp
TGTATACAACTAGGGCAAGCAAACTCTCTCCGTGTTTCCCATGAAAGATA
TGCGGCGTGCTGGTCCGGGGCAAGCAAACTCTCTCCGTGTTTCCCATGAA
MGGTATGCAGCGTGCTGCAGCATCCGGAATTACGTGCAGCCTTCCGAGTT
TTGGAGAATATTTAAAAGCTTTTTATTTGACGTGAGTTGATCAAAGTTAG
A
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A60.2GDsnp00252View
2Apple-FjxPL-F1-2013LG1N/A56.64GDsnp00252View
3Apple-X3259X3263-F11N/A52.85GD_SNP00252View
4Apple-X5210X8402-F1-ConsensusLG1N/A43.4GD_SNP00252View
5Apple-X5210X8402-F1-X8402LG1N/A53.2GD_SNP00252View
Contact
NameDetails
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com