GDsnp01035, GDsnp01035 (genetic_marker) Malus domestica

Marker Overview
NameGDsnp01035
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesMalus x domestica
Publication[view all]
Relationships

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit textureqFT.FjxPL-ch1Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp01035GDsnp01035Malus x domesticamarker_locus


Sequence
>GDsnp01035 ID=GDsnp01035|Name=GDsnp01035|organism=Malus x domestica|type=genetic_marker|length=201bp
GGAGCCTCAAGCGACTATTTTCGAATGCTTGACATACTTGTGTAGCGGTT
CCAATATCAAGTGGCACAGTTGTTCCAGCTTCAACCAAAACATCAGTAAA
YTCGGTACTGTTTAATCTCAAGTCTTCAATCTCCTCCACTGGCCATTGAA
GCAAATTGGTTCCAGTTTTGCTATCGAACAACACAGTCCTTGGAATGGTC
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A67.6GDsnp01035View
2Apple-FjxPL-F1-2013LG1N/A60.23GDsnp01035View