MDC009129.481, MDC009129.481 (contig) Malus x domestica

Overview
NameMDC009129.481
Unique NameMDC009129.481
Typecontig
OrganismMalus x domestica (Apple)
Sequence length23802
Analyses
This contig is derived from or has results from the following analyses
Analysis NameDate Performed
Malus x domestica Whole Genome v1.0 Assembly & Annotation2012-07-26
Alignments
Feature NameTypeLocationAnalysis
MDP0000193605 mRNA MDP0000193605:14062..20637+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_1 CDS MDP0000193605_exon_1:14062..14354+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_2 CDS MDP0000193605_exon_2:14957..15044+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_3 CDS MDP0000193605_exon_3:15160..15319+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_4 CDS MDP0000193605_exon_4:15495..15712+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_5 CDS MDP0000193605_exon_5:15948..16243+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_6 CDS MDP0000193605_exon_6:16706..16820+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_7 CDS MDP0000193605_exon_7:16909..17047+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_8 CDS MDP0000193605_exon_8:17326..17519+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_9 CDS MDP0000193605_exon_9:17639..17728+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_10 CDS MDP0000193605_exon_10:17805..17924+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_11 CDS MDP0000193605_exon_11:19162..19213+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_12 CDS MDP0000193605_exon_12:19381..19986+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000193605_exon_13 CDS MDP0000193605_exon_13:20231..20637+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654 mRNA MDP0000291654:8280..13035+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_1 CDS MDP0000291654_exon_1:8280..8447+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_2 CDS MDP0000291654_exon_2:8859..9250+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_3 CDS MDP0000291654_exon_3:9387..9471+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_4 CDS MDP0000291654_exon_4:9783..10005+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_5 CDS MDP0000291654_exon_5:10112..10215+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_6 CDS MDP0000291654_exon_6:10355..10442+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_7 CDS MDP0000291654_exon_7:10843..10997+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_8 CDS MDP0000291654_exon_8:11130..12128+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_9 CDS MDP0000291654_exon_9:12213..12599+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000291654_exon_10 CDS MDP0000291654_exon_10:12739..13035+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000715079 mRNA MDP0000715079:20949..23468- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000715079_exon_1 CDS MDP0000715079_exon_1:20949..21141- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000715079_exon_2 CDS MDP0000715079_exon_2:21460..21638- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000715079_exon_3 CDS MDP0000715079_exon_3:21718..22002- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000715079_exon_4 CDS MDP0000715079_exon_4:22143..22293- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000715079_exon_5 CDS MDP0000715079_exon_5:22891..23468- Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33665853_Lg3_01014_MAF30_MDP0000715079_exon1 genetic_marker RosBREEDSNP_SNP_TC_33665853_Lg3_01014_MAF30_MDP0000715079_exon1:23118..23118. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33668707_Lg3_01014_MAF40_520687_exon1 genetic_marker RosBREEDSNP_SNP_AG_33668707_Lg3_01014_MAF40_520687_exon1:20264..20264. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33670772_Lg3_01014_MAF40_282614_exon1 genetic_marker RosBREEDSNP_SNP_CA_33670772_Lg3_01014_MAF40_282614_exon1:18199..18199. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5 genetic_marker RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5:16061..16061. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33676570_Lg3_01014_MAF50_1683154_exon2 genetic_marker RosBREEDSNP_SNP_CT_33676570_Lg3_01014_MAF50_1683154_exon2:12401..12401. Malus x domestica Whole Genome v1.0 Assembly & Annotation
GDsnp01014 genetic_marker GDsnp01014:17157..17157. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33665234_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33665234_Lg3:23737..23737. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33665790_Lg3 genetic_marker RosBREEDSNP_SNP_TC_33665790_Lg3:23181..23181. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33665853_Lg3 genetic_marker RosBREEDSNP_SNP_TC_33665853_Lg3:23118..23118. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33667211_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33667211_Lg3:21760..21760. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_33667262_Lg3 genetic_marker RosBREEDSNP_SNP_AC_33667262_Lg3:21709..21709. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_33667271_Lg3 genetic_marker RosBREEDSNP_SNP_AC_33667271_Lg3:21700..21700. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_33667291_Lg3 genetic_marker RosBREEDSNP_SNP_GT_33667291_Lg3:21680..21680. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33667344_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33667344_Lg3:21627..21627. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33667350_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33667350_Lg3:21621..21621. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33667377_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33667377_Lg3:21594..21594. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_33667440_Lg3 genetic_marker RosBREEDSNP_SNP_GT_33667440_Lg3:21531..21531. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33667446_Lg3 genetic_marker RosBREEDSNP_SNP_TC_33667446_Lg3:21525..21525. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33667449_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33667449_Lg3:21522..21522. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33667455_Lg3 genetic_marker RosBREEDSNP_SNP_TC_33667455_Lg3:21516..21516. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33667514_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33667514_Lg3:21457..21457. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_33667525_Lg3 genetic_marker RosBREEDSNP_SNP_GT_33667525_Lg3:21446..21446. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33667559_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33667559_Lg3:21412..21412. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33667575_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33667575_Lg3:21396..21396. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33667616_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33667616_Lg3:21355..21355. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33667661_Lg3 genetic_marker RosBREEDSNP_SNP_CA_33667661_Lg3:21310..21310. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33667876_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33667876_Lg3:21095..21095. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33667884_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33667884_Lg3:21087..21087. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_33667896_Lg3 genetic_marker RosBREEDSNP_SNP_GT_33667896_Lg3:21075..21075. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33667926_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33667926_Lg3:21045..21045. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33668005_Lg3 genetic_marker RosBREEDSNP_SNP_CA_33668005_Lg3:20966..20966. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33668030_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33668030_Lg3:20941..20941. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33668058_Lg3 genetic_marker RosBREEDSNP_SNP_CA_33668058_Lg3:20913..20913. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33668069_Lg3 genetic_marker RosBREEDSNP_SNP_TC_33668069_Lg3:20902..20902. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33668087_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33668087_Lg3:20884..20884. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_33668204_Lg3 genetic_marker RosBREEDSNP_SNP_AC_33668204_Lg3:20767..20767. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33668218_Lg3 genetic_marker RosBREEDSNP_SNP_TC_33668218_Lg3:20753..20753. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33668273_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33668273_Lg3:20698..20698. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33668707_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33668707_Lg3:20264..20264. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33669416_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33669416_Lg3:19555..19555. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33669417_Lg3 genetic_marker RosBREEDSNP_SNP_CA_33669417_Lg3:19554..19554. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33669461_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33669461_Lg3:19510..19510. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_33669948_Lg3 genetic_marker RosBREEDSNP_SNP_GT_33669948_Lg3:19023..19023. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33670772_Lg3 genetic_marker RosBREEDSNP_SNP_CA_33670772_Lg3:18199..18199. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33671021_Lg3 genetic_marker RosBREEDSNP_SNP_CA_33671021_Lg3:17950..17950. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33671042_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33671042_Lg3:17929..17929. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_33671814_Lg3 genetic_marker RosBREEDSNP_SNP_TG_33671814_Lg3:17157..17157. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33671819_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33671819_Lg3:17152..17152. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33672079_Lg3 genetic_marker RosBREEDSNP_SNP_TC_33672079_Lg3:16892..16892. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33672187_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33672187_Lg3:16784..16784. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33672910_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33672910_Lg3:16061..16061. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33674128_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33674128_Lg3:14843..14843. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33674712_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33674712_Lg3:14259..14259. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33674763_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33674763_Lg3:14208..14208. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33676570_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33676570_Lg3:12401..12401. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_33676858_Lg3 genetic_marker RosBREEDSNP_SNP_GT_33676858_Lg3:12113..12113. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33676867_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33676867_Lg3:12104..12104. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33676972_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33676972_Lg3:11999..11999. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33677026_Lg3 genetic_marker RosBREEDSNP_SNP_CA_33677026_Lg3:11945..11945. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33677028_Lg3 genetic_marker RosBREEDSNP_SNP_CA_33677028_Lg3:11943..11943. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33677035_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33677035_Lg3:11936..11936. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_33677040_Lg3 genetic_marker RosBREEDSNP_SNP_GT_33677040_Lg3:11931..11931. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_33677047_Lg3 genetic_marker RosBREEDSNP_SNP_AG_33677047_Lg3:11924..11924. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33677056_Lg3 genetic_marker RosBREEDSNP_SNP_TC_33677056_Lg3:11915..11915. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33677058_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33677058_Lg3:11913..11913. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_33677092_Lg3 genetic_marker RosBREEDSNP_SNP_TC_33677092_Lg3:11879..11879. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_33677135_Lg3 genetic_marker RosBREEDSNP_SNP_CA_33677135_Lg3:11836..11836. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33677196_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33677196_Lg3:11775..11775. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_33677211_Lg3 genetic_marker RosBREEDSNP_SNP_CT_33677211_Lg3:11760..11760. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_33677216_Lg3 genetic_marker RosBREEDSNP_SNP_GA_33677216_Lg3:11755..11755. Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr3 chromosome chr3:28671745..28695546- Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

contig sequence

>MDC009129.481 ID=MDC009129.481|Name=MDC009129.481|organism=Malus x domestica|type=contig|length=23802bp
AAGGGAGGAACGAGGTGTAATTTTTGAAAAAGACATGGGGTATATTTGTC
TTAAAATGGTAAAACATTGTGTTCCACAGACGTGGAACAAACCCGTTCCA
GGGGGGGGAGGTGGAACGCAAAAACACCCAAAATCTGTCCAGTGGAACAG
CCCGTTCCACCCATTTTTGGCGCACAAACGCGGGAAGGAAAGCCTCGTCC
CGTTCCGTCCTGTCCCGTCCCACGTACCAAACGCACCCTATATGTACATG
TCCACTTCCTATAGCACGAGGCCTTTTGGGAACTCATTGGCTTTGGATTC
CATTGGAACTCCGAAGTTAAGTGAGTTTAGGCGAGAGCAATCCTAGAATG
GGTGATCCACTGGAAAGTTTTCGTCTGAGTTCTTAGAAACAAATCCGTGA
GGGTCTGGCCGGGGCCCAAAGCAGACAATATCGTGCTACAGCGAAGTCGA
GACTGAGATGTGACAGAATGGTATCAGAGCCACTCTACCGTTCGGTGTGA
GTGTGCCGACGAGGACGTCGGGCCCTTAAGGTGGGTAGATTGTAACATCC
CACATCGACCAACGGAGAGGGGGTGATGTGCCTTATATGTACATGCCCAC
CTCCTATAGCATGAGGCATTTTAGGAACTCATTGGCTTCGAATTCCATCG
GAACTTCGAAGTTAAGTGAGTTCGAGCGAGAGCAATCCTAAGATGGGTGA
CCCACTAAATTTTTTCTCGTCTGGGTTCCYAGAAACAAAACCGTRAGGAG
TGACCGGGATCCAAAATGGATAATATCGTGCTACGACGAAGTCGAGATTG
GGATGTAACATTAATGTTATGAGGCTGGAGAAGTCATACAATGCGTGCTC
TATTTCACTAAATATATTCACGTATTAAACAATTTAAAGTAAACTTCCTT
CAAATGTTAAAACACACAATATATTCGTATCTTTAATATAGCTCATGCAA
GTCAACATCAACGGCAAATAAAGCTGTTCAATAAAGAATATGCTACCCTT
TTGAAATGATATGCTACCCTTTTGAAAGGATATGCWAMCYTTTTTTTTCT
TTAATAAAGAATGTGCTATGTCATGTGTGATGAAAGACATTTATAAGTTT
ATAACACAATTTTTAATATCTTTATTTCTCAAATTTAGTGTTGTTATTAT
TATCCTTATTGCACTACAATACATTGACTTAAATATRTTATGGTTAGGAA
GAATGTCGTATAAGTGCACACTTATGATTTAAAAATCAAGCTAATAAGCA
AGATATCTTTTTTTTTTTTTGCTTGTTTTTTTTCACAATGATACTTTATA
AATTCTAATGGTAATGTCACATCCTCCACCAAAATACTGAAAGAAATTCA
GAAGCAATAAAATGACACTTCAAGTCATTCACGAAAAAATGACACTTCAA
GTCATTCAYGAAAAAATGACACTTTGAGTCGTTCACTAAATTGTGGTGTT
TAAAGACTATTAGGGCCCRTTTGGTGGGTTRGMTGAGATTGAGTCTTATA
ACAAGATTGGATTGGCARGGACATGTAAGACGTGACTTGTAACTCATGTA
TAAGGATARGTTAGATAACCCACTATATTGTGGATTCATAACTTATCAYG
TCTAGTTCTRATCATCTCACATTTTGACACATCAAACAATTGACTGGMCT
CAAGTTCATTTTAATTGGTCAYAATTTATCCCAACCAGCCCACCAAACAA
ACCCTTATTACCCGTAAAATTAATGTATATAGATATGATGAACAATATAT
AGATATGATGAACAATCTCGGCTTCTTTGCTGGTAGATTAACATGTTATT
TTTTAGGATGTCAGTTGCATCCTGGTTTTTAATCCTATACTCAATAATAA
GGTTGTTTCGTCTCAAACAYGCACCTTTATGTGTGGTAAATTTCAAGCTT
AACATGCAAATAACACAAATTGAGGGACATGAAGCATATGTGGTTGTATG
GCTTCACACGTGAGACAACATRCTCAGACATCAAGAAGGAAATTGAGGTT
CCAYGTAAAACCAATTGGCAATAAAGGAGAGTAGCCAACTACTTATAARC
ATATACAAGGATTTGACAAACAGGTTTGTCATATTCRTGTCCTTTACGTG
TCATACTCATYATCTTAGTGRATTTTGTCGTGTCAAACTCATTAAGATAA
CGGRTTTTTAACAGGTGATCTGATAACAACCWGACTCGTTAACTGGTYGA
GTTCATGGATCCTGSCAAACATTTTCATGCCTATTGTCTAATCCTAGAAA
ATGGGTCRTGGTCATGTCATTTATGTGTCATACTCGTTATCTTAAYCGGT
GRTCCGATAACRACTCAATTTGTTAACGGGTTCTTAAAGAAWTAATCCAA
AACGTGTKATTTTCATGATGTTTTGTGTCGGGTTAACRAGAGAAGGAAAC
AAATATTATAAGATGTTCCAACATCAAACCACATGGTAAGATGGAAGTAT
GRTCCCAGACCGAATCACATGCTAGTGTGCATGATTAACCTGATTACTTG
GATCATGTTCTTGGACCTAATTCATCATTCAAAAAAGAAACAAATATTGA
AAATAAAATAAAATAATAGAATCAGACAAATAAAAAATTGAGATGCAGTT
GAGGCTCTCATGCGCAAGCCTGTTCATAGATTCATGCAACATTATATGAA
TACAATAATTTTCAGTTGACCTGACAGTGTGCAACATTAAATGAATACAA
TAATTTTCAGTTGACCAGAAGATGTGCAACATTACATGAATACAATAATT
TTCAGTTGACCCAACAATGTGCGCATGCWGTATGCATATATGTCGACAAT
ATTAATTATTAGGGGTGTGTTGTTCACACACMTTTTTTTACATCTCAYGT
ACCTCTTGTTAATTTATGTCTGTTGATCTTCTTCAATTTATCCAATMCGA
YGGCCAAAAACTAAAAAGGTGTGRGAGAAGTAAAAAATGGTGTGTGRATA
TCACACTCCTAATTATTATTGGTCCAATACAAACTGTCATACTTAGTTTT
ATTCAATTCAGCTGAGTAAAATAAAGGTAATGCTATGAAAAYCAAATTTA
TAGATAAAATTTTAGAAATTAAAGGACATAGAAGTTGATKATTGATTTAT
TACTTAAGTGTTGTTAAACGTGTTCATTTCTATTTGTGACACATCATTTA
GTTTGCAAACTTTGTCTCCAAATTTAGTCTCCCTAGCATTACTTGTAAAA
TAAATAGAGAAATGCTAAGGAAACTTTCTCAAAGTGGGACTCTTTATAGA
CTYTCTGTCACCTTATGTTTTTTAACCAATTATCGTGCCAACTTTATAAA
ATAATATGCGCAAAATATGAGGTGGCAKATAGTACATGRAAAGTCTCACT
TTGAGARAATCTTCTTAGCATTTCTCGAATAATTAAGCCAATTCATAGAA
AAGTATTTCTATAGACTATACGTGGAGGCTAATCTGGTTTATCCGCTTTA
AAAAGAGAAAGAAAAGTTTTGAGATAGAGATTTTTCTTTCAGCTCAGTGC
ATTCTACGTTTAGACTCTTCAATATCTCTTATAGGTAGGAATTTATCGAA
CAAACTGCACTCATTCGTATTTTTTAGGAGTCCACTGATGAGAAGGGGCT
GGAGAAYATAAGCGCWATTTGATTGATTTTGAGTGATTAATAATGATAAA
AACAAATTTGGAGGGTTGGGCATTTGGAGGGTAATGACTCGTACTTTGTT
GGGTTTCTTTGAGTATTAATTTAACTCTAATTTAAGTACGTGAACATAAT
ACGCACTTATTCTTGTGATGGATGAGGAACAAAAAAAAWTTTATTCACAA
ATTAAAGCTAAAAGTTTCATGGGAGCCATCTACTCCACTAAGCTAAACGA
ATAATAATGAAATTAATCCATGTCGCACACACATGGTAGTTGTAGTTACT
AGTAACACACATACCTAAAAATTTATTAAAAAACCAAGTTATTTTATCAA
CATCGCATGTAATTCATGAAAACRCAAATTTGACATCCATGTCATATTAA
AACAAAATATCGCAGCACGTTGGTAAAAAAAAAAAARRATTACTTGAAGC
AAAAACTAATGTGAGGTTGCAAATCTGAGCTTAGCCAAGTTTGTTAGAAC
AATATACTCCTCCTTTTACACCTAAGTTTAAATTTCTATTTCTAGAATTT
AGGTTAATTTAATATGGAACATCGTTTGTATTAAAAACTAATGTTTGGTC
AAATGATTCGTTTTGGAAGTCATGGACTAAAAAACTCTGATTCCATTTAG
AGTGATGAATGATGTGCGATCATTACCACAAGTTAGGCAATGGTTTTGAT
TTACTAATCCAAGCCCTCTACTCCAAATATGCTAACAGAAAAGTAATTAA
ATTAAGAAATTCAAGTTTCACGATAACATGCACGCCGAATGCTTTATTTA
AAAAGTTTATCTTTAGGTCCACATTACACCAAATAATTTGCACCTACCCA
AATTTGGTAACCATGTCAGATTAAAAAGGATAGTGCTATCCACACAATTT
TTTTAATTTTCGATTGTCGGATCGAATAAACTAAAAATAAGCAATGACCA
AAAATTAACAAAAGTAGAAGTAAAATTAAGTGTATTAATAACACTATACT
ATAAAAATGGACGACCCACATGGRATGAAYAAGACCATCTCCAACCCTGG
CGTGGGGTTTTATCACAAAAAGCATTGGTGTTAGTTGGAGTGGGGTTAGG
ATATTTAAACTCTTCTTTTCTCATTGATAAGGTCGATGTGGGACATTTCA
ACATGCTCCCTCACGTGGGACCCAATTAGTGGGTCACACGTGGGAGATCC
ACACATCGACAACCAAATGGAGCCAAGGGGACTCACCCTACACACAGGGC
CAAGGAACCCACCATCATCGCACGGGGCCAAGGGGACCCACCCATCACGT
GGCAATACAGTACGGGCTCGCTCCCTGGCTTTGATTCCATGTGGAATTAT
TAGMGAGACAGGTTGAAGGCCCACTTCCAACAACACCGATAYTGTCCCCA
ACCTGGTAATTACCATCTGCACAATCAATCAGGTGTGTGGTTTTATCAGA
AAAGACCTTGGCGTTAGTTGGAGTGAGATTATGATACTTAAACTCTTCTT
TTCTCATTGATAAGGCCGAAGTGGGCATTTCAACAAATATTACGAATGTA
GGGTCGGATTGCATGGCTCTTCATCATTTTGAAAGTTAAGGAACTTTAAT
TTTTATGTGTGCGGGTTGAGTTACAAGTTCTTTTAATTTTTTAATGAATG
ATGAATAGATTCGACCAAAAAAAATRAATGACGAATAGAACTGTGAAATG
AGTAAAGGGTTCACATAATGCCTTTCTGAACTCATAATAATGATTTTATT
GAACGGTAATGATATTTGTTATTATTTTTTTAACAAACGACAATATTTTT
ACTAAAGAGGTACAAGAGTGGGTTAAACCTTATAATRGACTAGTCAGGCC
TCTCGCTTACAAGTAAAAAAGAATACTACTAAACCGTAATACTAAGTGGC
TATTAAGATAAAATATTGGTTGCATGGGAGAGGCTTTATCAAAATGAATT
TAAAATTTAGATTTTTATCACTAACCTAATTCATCATTTWAGTCCTTCAA
TTAGAAATCAATCAATTTCATTTCTAAGATTGACCAAATACATCAGTTTG
ATCCCTGCCATTAAATTTTCTATTAGTTTGCTAATGTGACACGATGTGAA
GCCCACAACACCACTCATATATCGCCACAATGTGAGTGAGCTCCACATTG
TGTCGTTAGTAAACTAACAGAAAGTGTAACAAAATTTAACGTCAGAGACC
AATTGATGTGTCTGGTCAATTTCAGACACACAAAATTTAACGTCAGACAC
CAATTGATGTGTCTGGTCAATTTCAGACACGAAATTGATCAATTTTCAAA
TTAAGTGACCAAATAATAGTTAGGTCAAATTCAATGATCATTTATGATAA
AAGTCCTTAAAATTTTGCATCGTAGTTTGTTGCAATGAGACATACATGAC
ACATATAATGGTTTATTTTAAAATTTTCACTTTATTATAAAGATCTTTAT
ATAGTATTAAAAATTGAGTGGTTTTTATTATAAAATTTGTACAATACAAA
TGCGTTTTTTTGCAAAGAGGTAGTTGGTGAGAGACCTTATGTTTGATTTT
CRTCAAAAGAGAATTTGAAYCACATTATTGCTAGTCCATTGTGAGGTTTA
GCCCACTCCTCCACTCCCTTAGTATAAATAATATCATTTGTTAGAAATAA
AAAATCACATTTTAATCACTGTTCTAAAAATCCCCCCTAGCACCGTCTAG
GCGCTAGGCAGCTGGCCACAACCCCGATTAATGCTTAGGCGTTTGAAAAT
TAAGAAATGGAGCCTAGACCTGCTAAGGGGCCCACCTAGACCGCCTAGGC
ACCCGCCTAAGTTGCAACTCAATTAGACAGAAAATAGATAACTTTCATTT
TGCATTTTATTTTTTACAATAAATTATTTGGGACTTGTTGTATACTTAAA
TGAACACACATTATATGCTTATTCCTCATRCTTTCATTATGTTTCAATAC
TTCATCATTATACTACTTGTAGTTTACGATGAAATTATATATATTTTAAG
TATAAACAKACACTTATATACACGAAATATAATATATTTACTTAAATTTT
CCTAGTTCGCTTAGGCCTTGCCTAGCCGCCTAGGCGCTAGGCCCCAGCAT
ACTGYCCGACTAGTSCCTAGCGTCTTCGAGAAAAAGAAAAAGAAAGAACT
TGAATTTGGGAAACAATGTCTTTAACACTATGTTTGGATGAAAAAATTTA
AGATTGCTAAGAAATTTTAAAATGACGRGATTTTATCTTCTAGAATTTGT
GAATTTTATTATTTGGTTAACAAAAAAGAACAAAAGAATTGAATATAGAA
TTTGTTATTTTTAATCTCTCAATCATATAAATTAGGAAATAACACATATT
TACATGAAATTTATACTTGGGAATTGGAGATCCCAAATTCCAATTTTTTT
TTTCTACGCTAAAATTCTAAATTTCTATATTTATGAATCCAAACAAGGAA
ATTGATGCATGCCAATTTATAAATTCTGACTTGAATTCAAATTTCAAATT
TATTTTCCTCATCCAAACATAGTGTAACGGTAGTAATTTCAATGTTACTT
TAATCGTTCAATCTAAGAACAACGAAACCAAAAAATGTATGTGAGATGAG
AAATGGTGTGTTAATGTTTTTTTTTAATAAGTCATTTCAAGAAATTGAGA
AATCCGTTTTTCTATTTTTCAATATTACAGAAAAGCAATATTGACATTGA
AAAACCATATCCTCAGTCCTCACAATGAAAAGTACACAAAAATTATATAC
TAAGAGTTGGTTTGTTATTGCTATGCTTTGAAGAAAAAAAAACTGTTTCA
CGTTTTCAGCTTTTTTTTAYCCAAAATTGTGAAAATAAGYTGTTTTTTAA
GCGTTTACCAAACATTTTTWTGAGCTCAACTTTTTTTTTACCCATTTTTT
ATAAAARAAYWAACCAGTACTAAAACAAATTCAATTGCAGCATCTTTTTT
TCATAAAAAAAAAAAAAAAAAAAAAAACAATTGCAGCATCTTTGATCGGA
TATTCCTCGGCAACCCTTCCCAAGTCGGGCCAAGTTTCAAGTATGTAAGA
GAGAGAGAGAGAGGAGATGAACAGTTGAAAAGTGAATAAACAAAGTCAAG
TATGGCCAAAGAGTGAAGCGTGTCAGTGACTGTGACCGACACAAAAAGTT
AAAAACAGCCAAACTTCATAAATCGGCAGACCAAGACACTCTCTATATAT
AATCGCTCCCACCCCTTCCTCTGGATCTCACACCTCTCTCTCTCTCTCTC
TCTCTCTCTCTACTCAGTCACTCACTGTTTCGCTGATCCCACTTTTCGTC
TTCATCTCCCAGCCGAAAGTCCAAACTTCCCCAGAATCAGGTACCCCRTA
ATATTATTATCCACAACAAAATACTCGATCATTCTTATCTGGGTCATAAA
AAGATCAGCTTTTTTCTCCATAAATGCTTTGCTTTTGTGTGCACAATCTG
CATGCTACGCGTGGCTTTTGCCCGTTGATTACTCCATTTTACAGGATCTA
TTTTTCTGGGTCCTGATCATTTTGTGCCATTGTGTTTTGATCCAATCCGA
GATTTCAGTCTCATTTGTTCAAATTCCTTTTTTTGGGTTTTTATTTTGTT
AWTTTTGTCAAGTTCTGAATTTTTGTGTTTTGTTTTGTGGTGGGTTAGTT
GTCCGCAGAGTGAGGCTCAGTGGGGAGCAATGGCTAACAGGAATCTGGAG
AAGTTGGCGTCCATTGACGCGCAGCTTCGGCTTCTGGTTCCGGCCAAAGT
GAGCGAGGACGACAAGCTGGTGGAATACGATGCTCTGCTTTTGGATCGGT
TTCTGGATATTCTCCAAGATTTACATGGAGAGGATCTCAGGGAAACGGTG
AGTTTTGATGGCTGTAAAATTTGRTTTCGATCGGTTTGAGATGTTCAATC
TTGATTTTGATTGGCCAAAAATTGGAATATGCTGCATTTTTATTCTACTG
CTAACAGTAKRGAACTTTGTGTGTGAATTTGCAACTCCTTATCAATTTTG
TTTGAACCCTTTTKATTTTGGTSGATTTGTGGATCCTTTAAGGAATGTAC
ATCWCGGGTTTCCGATAGAAATCCAATTTATATCGATATCCTAATGCTGT
TMATGATATCTTAATCAATAGTTTCCTAGGCCTATCAGTGGAGATGTTTG
ATTTGGTGAATGCCTATGATCTTTAAAGTTGTTGGTTTTTCGGAAACTGA
TTATGATAGTGTTAYGAGTTGCACGATTAAGAACAATTTATGTGATTYAC
TTGCATAGGTTCAAGCATGTTATGAGCTTTCTGCTGAGTATGAAGGAAAG
CATGACCCGAAAAAGCTATCAGAGCTTGGAGATGTATTGACAAGTTTGGA
CCCAGGGGATTCTATTGTTGTTGCAAAATCCTTCGCCCACATGCTTAGCT
TGGCCAACTTGGCTGAGGAGGTCCAGATTGCTTACCGCAGACGAAACAAG
CTGAAAAAGGGTGACTTTGCAGATGAAAATTCTGCAACGACTGAATCAGA
CATTGAAGAAACTCTCAAGAGGCTTGTAGGGGATCTWAAAAAGTCCCCCC
AAGAGGTTTTTGATGCTCTCAAGAATCARACTGTAGATCTGGTCCTCACT
GCTCATCCTACACAATCWGTTCGTAGATCCTTGCTTCAGAAGCACGGAAG
GTTTTCTTTTGATCTACTTCAGTCTGCATCSTTGATTTTCATTCGTAGAA
CGTTAGAAATAAAAGATCCCCATGTAGGTTTATGGCTTAGATTCTTATGG
CTCTTTCTCTCATCATGCACACTYACATTTCTTCAGGATTCGGAATTGTT
TAACCCAGTTGTACGCGAAAGACATTACTCCTGATGATAAGCAGGAGATT
GATGAGGCACTTCAGAGAGAGGTAATCATTTTACTTATTCGTTTATGTAC
TGTCAATTCTTTGATTTAATTGAMATTGAGCATTGAAAAAGGSCGTTRAA
AAAGGACTTTCRTCCACTTATGTATTGCTGAGAATATGTTTGACTCCTGT
AAAATGCATTTTTGTCAAATTTGAAATTCCRAGAGATTCAACGGTGGCAA
GATTTTCCAAATGTTATCTTTAYACGAGACAATCCGGAAGSATATTCTAA
GTCCTGTAGGATTTGAGTTTGAGCTTGAAATGATATCAGTYGTCAATTAC
TCTCATACATGTTGGTATTTCAACTTATGTAGATCCAAGCTGCATTTCGT
ACGGATGAGATCCGAAGAACAGCTCCCACTCCACAAGATGAGATGAGAGC
AGGGATGAGCTATTTCCATGAAACAATTTGGAAGGGTGTCCCAAAGTTTC
TCCGTCGTGTGGATACAGCTTTGAAGAATATTGGGRTTAATGAACGTGTT
CCCCATAATGCCCCACTTATTCAGTTTTCATCTTGGATGGGTGGTGATCG
TGATGGTACGTCTCTTCTTCATTAACRTGAATTATGCTATCTTGAATGTA
AGATACATGTGCCATCGCATCATTCRCTAATTTGAATTAACGTCTTCTTT
CATGGGAGCAGGTAATCCAAGAGTAACTCCCGAGGTCACAAGGGATGTTT
GCCTACTMGCTAGAATGATGGCTGCAAACTTGTACTATTCTCAGATAGAG
GATCTTATGTTTGAGGTACCTGAAAAAGCATCTTGAAATTGTGTTTRAGG
AGTTTCGTTTACTCATTGAAGTGGTTGTTTCTTTTTTGAGTGAGGCGTTT
GTTGCTTTACTGTGTTAGTGCCTGTATTTGCTAATTCCTTTTCTTTTCTG
GCAGTTGTCTATGTGGCGCTGCAATGATGAACTCCGTGTTCGTGCAGATG
TACTTCACAGGTCCACGAGGAGAGATGCAAAGCACTACATAGGTAATCAT
AGTTCTATTGTGGTTCRCCGCTTGATATGGTTTTTACATCGTGTACTGCA
TTTTTTTATGAGATGTAGAGGGAAACTGTTTACGTGATRGATTTAAAGAA
ACTAGAATGATTAATACGTTATACGTCATGCTGTAATATATTTCTTTAAT
TAAAGAGAACATTTTTKATAGTTGATGACTAAGTAGGTGCACAATGTACC
GACCAAGTAGAATTTTAAACTTAGTAAAGCCCTAGGAAAACTTAGCTTAT
ACAAATGTTTTATAGCTTCACAACCATATTTTACTGCAGTGACATAATGG
CAACAAACCTTGTACCTGGTTTTACTTATTGCCTTTGGACCTGTGAMCAT
TGTGCTGCTTGTGATACTTATTGCCTTTGTTTCACGATTCAGAATTTTGG
AAGCAAGTTCCTCCAAATGAACCCTACCGTGTGATTCTCGGTGATTTAAG
GGATAAGCTTTATCATACACGTGAACGTTCTCGTCAGTTGTTAGCCAGTG
GGCACTCTGACATTCCGGAGGAGGCAACACTGATCAGTGTTGAGCAGGTA
CTGCCATTCTTAATAAGCTGTACCGCAGATTCACAGTCCATCAAATACAA
TACCAAATGATGTCTTGCCTCTTTATTCTCTCTTCTGATTAATGACTGTW
GTCCTAATTGTGATTTAAATTATGTCTAGTTCTTGGAACCTCTCGAACTC
TGCTACAGATCACTCTGCTCTTGTGGTGACCGAGCAATTGCTGATGGATC
ACTTCTTGATTTCTTAAGGCAAGTGTCCACCTTTGGACTTTCACTTGTGA
AGCTCGATATTAGGCAAGAATCTGACAGGCATACTGATGTGATAGACGCC
ATCACCAAGCATCTGGAAATTGGTTCCTATCGTGAGTGGTCTGAAGAACG
CCGTCAGGAGTGGCTTTTATCTGAAYTATGTGGCAAGCGCCCACTGTTTG
GTCYTGATCTTCCAAAAACGGAAGAAATCTCTGATGTTTTGGACACATTA
CATGTGATATMAGAACTTCCATCTGATAACTTTGGAGCATACATCATCTC
AATGGCGACTGCTCCATCTGATGTGCTCGCAGTTGAGCTCCTGCAACGTG
AATGCCAYGTGAAGAAACCACTAAGAGTCGTTCCACTGTTTGAGAAGCTT
GCAGATCTGGAGGCTGCTCCTGCTGCTTTGTCACGGCTTTTCTCGATTGA
TTGGTATAGAGAGCGGATCAACGGAACGCAAGAAGTCATGATTGGGTACT
CAGATTCTGGTAAAGATGCAGGGCGTTTCTCTGCAGCCTGGCAGTTATAC
AAGGCACAGGAGGAGCTTATCAACGTTGCTAAGAAATTTGGTGTGAAGCT
AACTATGTTCCATGGTCGTGGTGGCACTGTTGGAAGGGGAGGTGGTCCCA
CCCATCTTGCTATATTGTCTCAACCACCAGATACAATTCATGGTTCACTC
CGTGTCACTGTCCAAGGTGAAGTTATTGAGCAGTCGTTTGGAGAGGAGCT
CTTGTGTTTTAGAACACTCCAGCGTTTCACAGCTGCTACACTAGAGCATG
GAATGCATATGCCAGTTTCACCAAAACCGGAATGGCGTGCACTTATGGAC
GAAATGGCAGTTGTATCTACAGAGGACTATCGCTCCATTGTTTTCCAGGA
GCCCCGATTTGTCGAGTACTTCCGTCTTGTAAGCATTTGATACTTCACAT
TAATCACATTAGCTTTAAATGCTCTGATTAATTACAATGACCATTGCGTA
CATGTGATCCAGGCTACACCAGAGCTGGAGTATGGTCGGATGAACATTGG
CAGTCGCCCCTCAAAGCGAAAACCWAGTGGTGGTATTGAGTCACTTCGTG
CAATCCCATGGATTTTCGCATGGACACAAACAAGGTTCCATCTTCCTGTG
TGGTTAGGCCTTGGAGCAGCCTTCAGACATGTCATTAAGAAGGACATTAA
GAATCTTCATATGCTGCAAGAGATGTACAACCAATGGCCTTTCTTCAGGG
TCACCATTGATTTGGTTGAAATGGTGTTTGCCAAGGGAAACCCCGGAATA
GCTGCGTTATATGATAAACTCCTTGTTTCYGAAGACCTATGGTCATTTGG
AGAGCGATTAAGGTCCAACTATGAAGAAACCAAGAACTTTCTCTTACAGG
TAAAATCTTCGACTTTAAGATAGCWCTTGTTACATTTTGAGTACATCCTA
AAATATACGAAGAAATTCATCAGTTTTCTCTGAGCATCTGTGGTGATTTG
TTACTGCATAWACTGACGTTTRCCTTTTCCCTTGGCAGATTGCTGGACAC
AAGGATCTTCTCGAAGGGGACCCGCACCTGAAGCAAAGACTCCGCCTGCG
TGATTCATACATCACAACCCTCAACGTCTGCCAAGCATATACACTGAAAA
GGATCCGTGACCCAAACTTCCATGTGACACTACGGCCACACATCTCAAAG
GAAATCAGCGAATCAAACAAACCGGCTAATGAACTTGTGAAGCTGAACCC
GACAAGYGAGTACGCGCCTGGTCTGGAGGACACCCTCATCTTGACAATGA
AGGGTATTGCTGCCGGCTTACAGAACACCGGTTAAATGCCTGTATCTGCT
CTTTTCTTTATGTTTTTCTGCTTTCGAGAGACGGGTTGTGTCCCRAAAAA
ACTGAAGTTAAATTTACCAAAAGTGGACGATGTCTTTTGATCGTCCACCT
AAAGGCCARATATTKGAGTGAACTTGGTTAAGTTCTGTGATCAGATTGCT
GTGCAGAATAACTAGAGCCAGCATTGTTATTGTTGCCACAAAAGAAATCA
AACTCTCAGTGGAACTGTTTTGTTGTGCTTCAATACAAAGGGGCATTTAT
GTGCTTCATGTTTCATGGCTTGGTTTCTTAGCCATCAAATAATCCCAAAA
TGAAATTTTCTAGGATTGTTTTACACAAACGCAAGGTWGTAAAATATCGC
YTGTATAAAAAAGTAAAAATGATTTATYGGACATATATATAAGMGGAAAA
TAAAATATAGAAATGTCAATAACGAGGCCATTCACGGGTTTTTTTTTACA
ACTATCCTTTCAAAGCATGTTTTCAAAACGTTAATTTTCYTGCATAGCGG
ATTGCACAACTTTGGCTGCAGCTCGAAATGCTTTCATCTTYGAWTGTACG
AGTTGGGTTGTGTAAAAGGATTCAAAAATCAAGAATAACRTGTGAAGGGT
TCTTTTTCTTTTAAAAATRAGACTAGTTRRTGATTTAGYTACKATAATTC
ATYTTTTCGRCCTCMGAAAAGATTCACTAGGTATTTTAGCCGAGCTCCAT
CATGTGATTCACAACGTGCTGTATAAAATAYARAYYTTAAATTCGTTTCA
AAATACTGAACTATCGCGTRATGATTCGCACATGAGAGGGTTAAAAGAAA
TAAAAAGGTAATAGTTTTGAATAATGTGTTATGCTAAAGTTTGGGAAAAT
AATTTGTTTTGTAACTTWTGGGAAATAAAAATATGAGTKTAACATAAGTG
RTGGTGGTGGAGGTATYTCTTAATCTTTACTTCCCAAGAAAGCAAAGAAT
CATCTTTTCTCTGCAAATCCATTTCACYCAGTAACCCAGAAAAAGCTACA
GCGAGTTCACCATGTCTCTGTCCACGAGGCTGAGACGCCCTCAGCCGTCC
GATGACCCTTCTTCATCATCGTCGCCGCCGCCGCCGCAGTCGTCGTCATC
TTACTCGAAAGTCGACAAGCAAGGGAAATCGGACGGCGGCGTCGACAAAG
GGTTGGGGTGGTTCTTTCCGTTGGTGGCTCTGGGAATGCTGAGGTACATG
AGTGCCACGTCAAACATCATACACGACTGCGACGAGGTCTTCAATTATTG
GGAGCCTCTCCATTTCCTTCTCTACAAATCTGGCTTCCAAACTTGGGAAT
ATAGGTACCCTTTTCAATTCTTTTCAAATTTTGCTTTTTCCTCTCTGAAA
AWTTGAAATCTTGAAATCTTGGCTWTTTTTTTGGGTTTTGATTGTTTTTC
AGTTTTTTGGTTATTTGAAGTTTRTTAGTTATTAAAGATGTTGGTATATG
CTGTTTTTGGTTATAAGAAGTTTATTACTTATTGGGAAATTTGGTTGTTG
TCGAAAAGTTAATTGCTTCTTACTCAATGTACAAGATTGTGTAGACCATT
GCAACTCATGAACAATTTGCAACCTTCTTATGAACCAATATGATTTCGTT
YGTTACAGTACTTAGTAAGCGAATCTCTAGCGTAATGGCTTTTGKTTCAT
TGAATTTGACTTYTACAAACTGACATTAGAATKGATTCTATGGTGTAGAG
TTATGTGTCTCAGATTAGTATTTTGTAGGTGGAGTTAGATGCTCGTTATT
GTTAACATAGTATTTTTAGCTCAGTGATTGTGTCATTTGTTGTGTGCTCT
TAAATTACTGCCTGCTTCACAGCTGTTGTGAATTCGATAATGAGTGCTAT
CATTTTGTATTTTAGAAATYCTACYTATGGTTTTTGTTGTTATATGCTTG
TTGCAGTTCACAGTTTGCACTTCGGTCATATTTGTACATTCTTTTCCATG
CATTGGTGGGTCAGCCTGCTTCCTGGTTGTTTGCTGAGGAAAAAGTAAGA
TTTCTTATTGCCCTTGCCTTTTGAACTGTATCCTCTCATTGTTAGCCGAA
GGCTATGTCTTGCCTTCAATTATATATAGTTGTGCTGAACCAATTCTTTT
TGCTTATAGGTGAGAGTATTCTATGCTGTTAGAATCTTTCTTGGTCTCCT
TTCTGTTATCACTGACACTGTCCTGGTAGTTGCTCTTTCAAGAAAGTACG
GAAAACGCCTTGCTTCTTACACACTTGCAATGCTATGCTTAACCAGCGGT
TGTTTTTTCGCTAGCACAAGTGGGTTGCCTTTTCATTTTCTCCTTTGATT
TGAAAATTCCATTGCAGGATTTCTAACATCTCTRTTTTTGTTTTGTGATT
ATTCATTTTGTTTTCAGTTTTCCAATGTTAGCTCTCTTAATTTTCTGGAG
CTATTTATTCCATGAATGACAGTGTTGTTGACATTATTTTCCAGGTTTCT
TGCCAAGCTCGTTCTCCATGTATGCCATGTCTCTTTCATCCGGTTTATTT
CTGCTTGATAAATACACCATGGCAGTTACAGTTGCAGCCGTAGGTGTAAT
CCTTGGCTGGCCATTCTCAATCTTGGCATTTTTGCCAGTCACATTCTACT
CTCTAGCTAGAAGATTCAAACAAGCTTTTCTTGCCGGGGCCGCCATATCT
GTTGCTCTTCTTGTAAGTCATTATTGGTATTTTGTTTGTGAATGAACAAC
GTATAGTGCCTGTACCTATGTTTAAAGGTCGTACCCAGTGCACAAGGCTC
CCGCTTTACGCAGGGTCTGGGAGAGGTGAATGTCGGCTAGCCTGTACCTA
TGTAATTGGCACAAATAGAGTTATAATTTCTTATGTTAATTTATCGCTTT
TTTGTTTTCTTTATCATGCTTACGCTTATACATTGGAGGTCTTTCAGGTA
TTCTCGGTTCTCGTTGATCATTACTACTACAGCAGATGGACATCATCCGT
GTTAAATCTGTTGATCTATAATGTTGCAGGAGGCGGTGAGAGCCATTTGT
ATGGAACTGAGGGGCCGCTATATTATTTAAGGAACGGATTTAACAATTTT
AACTTTTGTTTTGTACTTGCATTGCTGTTTCTGGCAATGCTGCCGATTGC
AAGGAAAAAGTATGCCCCAAACTTGCTGATTGTTGTCTCACCAGTATATA
TTTGGTTGGCATTCATGTCTTTGCAGCCACACAAAGAAGAAAGGTTCGAA
TAAATATTCCGATATCTGGGAAAAACTGTTGCACTAACTTTCCTATAATT
GGTTGAATTTGAGTATGTTCCTGCTAGTTAATATTGCTTATTTTCGACAA
AATCTACCATTTCCCAAATTTGCACAATCGTGCATTTGCAGTAAACAATT
CAAATGCTGTTGRTAGCTCTGTCTCTGTGCTTGACGTTTCCATTTATACT
TTCTCCTCTATATTATATAATAAACAAAAATGGTTTTTTTTCTTCCTAAT
TSTCTGCAATTACAGTAACTCTTAAGTATTTCCATACATCTYACCATAAT
CATAGGCAGCACTCACTTTGTAGTCTCAAATCGGAATATTTAGTGYGTCA
ATTTGGTATTTTGGTGAGGGCACAGAAAATCTGAAGATTGTTCAATGTTA
GTCAAGTGCAGGTTAGAYGTGATTGATAACTAGATATTTCCATTTATCAT
TGCAGGTTCCTTTATCCAATATATCCACTAATTTGTGTTGCTGCATCGGC
TGTCATTGAGAGCTTTCCTGATGTTTTCCGATCTGATTATGATTCCCAAG
GAAATTCTCCAACGGTTATGGTAAGCTTATCCTATTTTTCATAAAAAATA
TTGTTAAATTATCTTTGCGAACCTCTCATGGTCACACTATTATTATTTAT
ACATGCAGACAGCAAAGATTCTGAGACCGGTGGTTCTTAGCTTCATATTA
TGTGCCTCCCATGCTCGTACGTTTTCAGTGATCAATGGTTATTCCGCCCC
TATAGAGGTTTACAAGCTTTTAGAGCATCATGACGATGTAGGAACAGGTG
AGACCAACATCTTGCTGYTATGTTCTKTTAACAGTTAATTTAGTATGGAT
TCTTAATATTTGGAATGTACAATAGAAGAAAACTCATGTTACAATTTCAT
ACACTTACATATCGGTTAGGCTCACCACCTAGATTACTTTCCCACATCAA
ACTTATTTTTCTTGTTGACGTCTCAAATTGTAAGGAACCTTTTGGGTTCT
GAAGTTGATGTTCTGTTATGCAATTTTTGGAAGTCATGTAGTTCTGAAAA
TTCTGTTTTCCCTTCTGAATTTCAGGTTCTGTTCTCTGTGTTGGAAGTGA
ATGGCACCGYTTCCCATCATCATTTTTTGTTCCTGATTATGTGGGAGAGG
TCCGTTGGATTGATGATGGGTTCAGAGGACTTCTTCCCTTCCCATTCAAT
ACCTTGGGTGGAACTGCAGCAGCACCACCATATCTTAACAATAAGAACAA
AGCATCTGACTTGCAATATGTAATTAATCACCATTCTCTATRCTAGTTTG
TTTAAAACTAAAGGGCCCTGTATTTGTTATGGTTTCTTTTCAATATATAT
TGTTTTCATTGTAAAATGACCAATCATTCTTGTTACAGCTCCGGGATCTT
GATCAATGTACGTTCCTTGTCGAGCTGCAGCTTAGTCGGCCTTTCCCTTC
TCGGGGAAGTGACTTATCAACTTGGGAGGTAAAAATCAGTCTGCTGTTAC
ACTTTTCCCTAAATGAATCACCATGTGCTGAATTGGTTTTCTTCTAAATT
TCAGGTGATTGGAGCGTTGCCTTACTTAGACAGGGAGCTCTCGCCTGCCA
AGTACCGCTCCTTTTTCATCCCGTATCTGTGGCAGCATAAGAATATTTTT
GGCATGTACAAGCTGCTTAGAAGGGTACTGAAATGAAAGGAAGAACACCG
CCCTCTGATAGTTTTAGATTCTGAACCAGCATGACTTCTCTGAAGTGCTA
ACCCGCCCACTCGTTGGAAGGAAAACAAAAGTAAAAGGAAGATCAACACC
CCCCACCGAAAAATACCCCCACCTCCACCTCCTCTCTTTTTTGATGTGGT
TTTAACTGTTTTGGTAGGTGTGACTTCCTCAAAGTTCTTACTGATAAATG
AGTAGTTGAGTTCAATAGTGTCTTGCATTGCGTGTATTTCTAACGGTTGG
ATGTTCCCAAGTTCGTCTCAGAAACTTTTATCTTGTGTTAGATTGAGAAT
ACTTGATGAAAATATGAGAAATTTTGAGCCTCTTCTGTCTTTTGTYTTTG
CTCTTGAAATTGAGATTTTGGACTCGTTTKGTGCCTTTRATTGGACTGGA
TTGGGTATCTCATATAATTCAARGGTGTATGTGTGAGGTGAATGATTGTT
TATTTTAAGAGGATTCGAAAGGATTAGACAWGAATGAAATTTATCCCTTC
GGACGCTCCAATTTTGCAGGGATTGAAAGGGAAAAGTATTTTAGACGAAC
TATAATTTATTTCTTCAACSTGCCTCGAAATTGAGTATAGTGAGTWGTTC
AATCCATTTCAATCCTAAGCACCAAACGAGTCTAATCAAGAACGAAAAGA
AATTTAGACCATAGATAATTGATGGAAGTTTCAACTTTGAAACTTCAAAT
ATGTGAATGTATGAAATTTCTTCGTCTTTTTGAAGAGGTCAACTTCAAAC
TTRGAAACGTTTCACTTAAGGGTTAACAATTCCTTTGGCCACTTAGTACT
ACTGTKTGCTGGTATTCTTCTTCACTTGTAAGTGARAGCTCTTAGGTTCR
AATCTCGTGAATGGCGAATTCGATAYCAAATTAGATTAYTCATTATGTGA
CTTAACCAAACTCTCCATCTCTTTCGTATAAAATGTATMGTTGTAAAAAA
AACACATCTTTTGTGAAAAAWAAAAATAAAWAAAWAAATTAAGCAATTGA
TGACTTTTTTCTCACTTTTTGATTTCTCCTTGAGACTTGCTTGGTCAGCC
AAAGAAAAATCTAGGAAAAAACCAAATTTAAAATCCCTAATGGAAGAAAA
ATCTATGAAATTAATGGCTATAAATTGAGGTTGTTTGTCCGGGAAAAAAC
CCAAGACACCAAATTAGGGAAACCACTTTTCATTTAACCTAACAAAATRC
CTGAAACGAAGGCTCTTTTGCCTGCCATTGCCACTCTTGCTGCTTCAGCA
ATGCTTGTTCAAAGTATTGCCAACGACTTCATCCCGACRAACTTCGGAAC
TACTTCTATTCGGGCCTCTATAACATTKCACGACGYTTCTCTTCTCAACT
CACCAWTGTCATCGACGAATTTCAAGGACTATTTCCGAACGAAATTTTTG
AGGCCGSTCATGMSTATTTGGGCRCTATAGYGACCCCCCGTCTGTYCGAA
GAATCAAAGCGAGCAGCSAAAGAGAAGAAACTAGCAGTGTCAGTGGACAG
AGGTGAAGAGTTAGCTGATGTATACGAAAATGTTCAAGTAAAATGGAAGT
TGATTTATGTAGAGGTTAAATCACCATTTGCTAGACATCGGGGTGATCTT
AATGCATCGTTACGACAAGAAGCAAGATTCTATGAGCTAACGTTTCATAA
GAAACTCAAAGAGAAGGTGTTGAACTCGTACTTGCCCTACATTCTTGAGA
GATCAAAGGAAATTAAAAGAGAACACAAGGCAGTAAAGTTCCACACAGTT
GAACAGCAGAGATGGTTCCCGGATGCTGTCAAGCTCGACCATCCAATGAC
CTTCAAGCTCCTAGCAATGGATACAGAACTTAAGAAAGCTGTGTTGGATG
ATTTAAACAACTTTATAWATGGAAAGGAGTTTTACAGAAGGGTCGGCAAA
GCTTGGAAGYGTGGATACTTGTTATATGGCCCTCCYGGCACAGGCAAGTC
AAGCCTGATTGCAGCCATGGYTAATCACCTTAACTATGACATCTACGAGT
TGGACCTAACAAGCGTTAATTCCAATTCCGACTTGRGTAAGCTGTTGTTT
TCCATGCCTAACCAATCTATAATCGTCTTTGAAGACRTTGACTGCACAAT
CAAGCTGCAAAATGGGGGAACCGGGGGATGAATCACGGAGGAACAACAAT
AAAACTCAGGTCAGTTTACACTTTTACATTTAGAGCATGCATGACTAGCA
TTGATTAAACCGTTGGTCACTCAAGTTCTAGAYGAATRGAATAACAGAAT
TATATCGCTTTAAGAAACTAATACTTACAGATATATGTGTTATCTTACTA
TTTCATCGACAGGTGACACTCTCTGGGCTCCTCAACTTCCTTGATGGTTT
TCCGTCATGCTGTGGTGAAGAACGCATAATTATCTTCACAACGAATCACA
AAGATAGGCTAGATCCTGCTCTASTGCGACCAGGCCGCATGGACATGCAT
ATCCACATGTCATATTGCACCACTTCGGCGTTCAAACAGCTGGCATTCAA
TTACCATGGTCTTTGTCATCACAATCTCTTCGAACARATTGAAGGGCTCA
TACGGGAGGTTGAAGTCACGCCAGCAGAAGTTGYAGGACAGCTAATGAAG
AGCAAGAATGCTCACAYTGCGCTCCAATGCCTCTTYGATTTCCTTCTCGA
GAAGAAAATTCAACATAAAGGAGAAGAGGAAAGTTGATGTCATGGTTGAA
AGGCCAAAGAAAAAGAGATGTATAGAGATCTCATATCGTTTGTCATGTAA
TACGCATAAACTTTGCAGTTTGCACCTGTTGATGTGTACTAAAGACATAC
CCAAGCTTCCATTTGTTTGATTTTGTAATATATCTTTTTCTAACTTTTCA
AAACGATTATATACTAATATTTGAATTATGCAATTACTTTTAGTTCCAAA
ATTAACTCATCGTGCCACCAAATTCTGTGTACTTGTCAGAATGGGCTCCA
GAAAGAGCAAAAGAAACATAATGGAGGAAAAGGTTCTTACTTTTTCAATT
AGGATGCAAGAGGCAGTAATCTTTTGACATCAGCTCCCAGAAAACGAAGT
TTCATATCTAAATTCTCATAACCACGGTCAATATGAGCAACACCGCTGAT
CTCTGTAGTGCCTTCTGCGGCCAACCCAGCTAATACCAGTGACACCCCAC
CCCTAATGTCATTTGCAACAAGCGAGGAACCATTCAAGACACTGACATGA
TAACAGACATGARTCAGCACAATCATGCTATTTTCCAATTGGGAAAAAGG
AAAAATTAGAATATGAAAAAGGAAAATCTGCTTGCCTTCCATTGTCTTTC
CCATAAACCAGAGCAGTGCTCGCACAGACCTGAATCTTTGCTCCAAGCTT
TAGCAGTTCGCTTACTGGTAGAAAGCAGGGAACATGTATAAGAATATCTC
AATGTAATTAGTACTATTTGTAAGCAATATCATTGGTTTCCCAAACAGGG
AAACAAAAAGACGACAAGAATACATATATAATATGCATGCCAGCACACAC
ATTATCCACCACATACCATGACTCATGCGTTTGTCAAATACAGATTCCTC
TACAGAACTTAAACCATTGCATGTAGTCAGCAAAGCCATTATTTGTGGTT
GGAGGTCTGTGGGAAACCCAGGATATGGGCCTGTCTTAACCACGACGCTA
AGCAAATTTTCACCCCCACGCCCAGACACTGCTGAAACCTGAAGTATTTA
TCAACTATAAATTACCACAAGATGCAACCCAAATGGGAACAGAAGAATTT
AAAGACGATTTACATACTTCCAAGGTATCATGAGAACATTTCTTGATTTT
GCAACCAGCGGCCGATAGTTTGTGTATCAAAGAGGACATTTGGCAAGGTA
TGACAGGTGATATTGAGATGCATGAGCRAGTAATWGCTGCAGCAAGCATA
AATGTACCTGCTTCAATACGATCAGGTGCAACAACGCATTCACAACCAYG
CAACTGGGATTTTCCYTTGATAACAAGCTTGTTGCTGCCTGCTCCATCCA
CACAGGCCCCACAGTTGGTAAGAAACCTAGCAAGATCAACCACCTCTGGT
TCCTACGGTGAGTTGTTGGGAAAGTAAGTTACTTCACYATGTTAACATAA
TCCAATTAGACAGCAAATGATAACTGTTAACACACTTCTATTGTTATCAA
AATCAGAATCTAAAATGTTCAGTGAGATTCATCTTATCRTACTCTGGCAA
CATTGGACAGTACAGTTGTTCCATCAGCCATACATGCAGCCATCATAAGA
GTTTCCGTTGCCCCCACACTCGGGTAATCAAGTTGGAAACTTCCTCCAAC
TAATCCTCTTCCATTTGCGGCATATGCCTGAACTTTCCCATCCCTGTATA
TTGCTAAAAKTWTACTGGATCAACTCATCTCATCATTCATAAACCATGAA
AATAACAACAACCAAAAACTTTAGTAAACAACTGTGAGCASCACAGGCAA
AATTGGTGGAGACCTGTTATTCARACGGMAAATGYATMGGGTAAAATATG
TACTTCATGATGGTTAACACWAGRGAACACATAYACATATGCATCAATAA
TAAAAAAAAATCCTTGGATGTCCTAKAGASAGTRTTTTATCATCACACTA
CATTCTCTGCCTTTTGATGATTAATAAAGKACATATGCTKTGCTTCAGTG
GGCAAGAGCACCTTTTGCTTCRTTCGTTACTTGGCACRCTAGAGTTTGTG
AAAGAAATTGTGCATCTGGCAKTACGCTTARTAGCRACTCACCACCTAKA
ATATCACAATTCAGGCAGAYACATTTATCATAAAGTGACTATAGAACCTC
TTCTACACTGCAAATTKASMAACYRTKCTTRCKSTCAWTMWARWCTKAWA
RATAAATKTAGSAAMCWTTCTATGAACACATAAATCAAACAATTATGCGC
TTCCAATATAAACTTAAAGATAAAATGTAGGAAACTTGACCTCAATTCAA
CAACAGCGCCAAGAGATTGAAGACCCCGAATGTATAGGTCCACTGGTCGA
GCCCCAATATTGCAGCCACCGGGTAATGCAACCACCGCCTCCCCGAATCG
GGCAACCAACGGCCCAATGACGAAAAACCCACCTCTAATCTTTTGAATTT
CATCCGCATTAGGCTCAACTGAGCCAACCCCATCGGTGTTAACCAACATT
TCGTTGTCCAAGACTTCAACTTTAGCTCCAAGAGACACTAAAACCGAAGC
CATTGTGCGAGTATCGAACAAATCGGGCACATTTTGAATCCTTGAAGTGC
CTGAGCAGCAAAGGGTCGCCGCCAGAATCGGCAAAGCTGAGTTCTTGGAG
CCGCTGATGGGTACATGGCCGGAAAGCTGGGAAGGGCCGGTGAGTATGAG
CTTCGGGTAAGGGGTTTGGATTTGGGTTCGGGTATCGATTTCGGGTGCCG
GAATCAGTGGTTTTAGAAGAGAATGGGGAAGGGTTTTGTGGGTTTTGGAC
TTGGTGAAAGGTTCAAGGTAGAGAAGGAAGCCATTTGTGAGATGTGAAGT
TGCCGCCAAGTTCTTCATTGGCTACTTTACCYAGTTGACGTTCTCTTTTG
TTTTCAAAAYTTTTTGTTTTTTTTTTTAATTYTTTTTTATACCTTCTAAC
TTTTTATTTGTTTCAAGATTTTGTGACTGTTATTTTCCCTATAAAAAATT
AGAGATAAAACTYGTGACCTGAACTTAAAATTTCTTATTTACATATAGAA
GAAAATATCCTAGACTATTAGTGCATACAATGTGTTTTACCTTTTAGTGT
TGCATCTCAAGCTTTTCAACGAAAATTTTGCAAGCATTGATCAATACATA
CGTTGTATTTTGAGATCCAGTTGATCGTTGTAGTTGGTAGCTTCATGTAA
AA
back to top