GDsnp01474, GDsnp01474 (genetic_marker) Malus domestica

Marker Overview
NameGDsnp01474
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesMalus x domestica
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map10N/A72.2GDsnp01474View
2Apple-B-F1-2014B10N/A87.2GDsnp01474View
Sequence
>GDsnp01474 ID=GDsnp01474; Name=GDsnp01474; organism=Malus x domestica; type=genetic_marker; length=201bp
TTATATATTCAAATATTTCGACCGTCGCCAACTTGTGCATCCCAAGCCAA
ATGTAAAATTTAAACTTGGCTGGAGATGTAAAAAATTAACAATCTTTGAA
WCATGCTCTTAGTTGTATATGATGGAAAGAAAATAATTAGTATCATAAAA
TCTTCCACATTTCTCTCCCCACGCTCTTTTCCTTGCCCACGGAATTACTT
T