GDsnp00034, GDsnp00034 (genetic_marker) Malus domestica

Marker Overview
NameGDsnp00034
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesMalus x domestica
Publication[view all]
ContactCindy F. Verdu
Contact
NameDetails
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map11N/A27.1GDsnp00034View
2Apple-B-F1-2014B11N/A21.8GDsnp00034View
3Apple-GDxBr-F1-2013LG11N/A40.45GD_SNP00034View
Sequence
>GDsnp00034 ID=GDsnp00034; Name=GDsnp00034; organism=Malus x domestica; type=genetic_marker; length=201bp
CGCTCTTTTTTATTCTTTTCTTCCAAGATATGTCAAACTTCAGGACTCTT
CATATATACTGCTTTGTGTTCCCACTACCTTTGCAGGAAATCATAACTGG
RGCAGGTCATACCAGTGCAGTGGACTGGTGGGCTCTTGGTACGTAATTTA
TTCAATTTCGTATTTCAATTATTTTTCCGGCTTTTAGTATGTCATCTCTG
C