|
Marker Overview
Name | NB102a |
Genbank ID | N/A |
Type | SSR |
Species | Pyrus communis |
Repeat Motif | (AG)6 |
Primer 1 | NB102a.forward primer: tgttatcacctgagctactgcc |
Primer 2 | NB102a.reverse primer: cttcctctttatttgccgtctt |
Publication | [view all] |
Contact | Toshiya Yamamoto
|
Publications
Year | Publication |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
2002 | Yamamoto T, Kimura T, Shoda M, Imai T, Saito T, Sawamura Y, Kotobuki K, Hayashi T, Matsuta N. Genetic linkage maps constructed by using an interspecific cross between Japanese and European pears. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Dec; 106(1):9-18. |
|