|
|
Marker Overview
| Name | NH008b |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pyrus pyrifolia |
|---|
| Repeat Motif | (AG)19 |
|---|
| PCR Condition | 55 |
|---|
| Primer 1 | NH008b.forward primer: GGAAAAGAGAAGGAAGAAGAGAAGG |
|---|
| Primer 2 | NH008b.reverse primer: TGATAGGGGCATTTCGGTAA |
|---|
| Product Length | 205 |
|---|
| Publication | [view all] |
|---|
| Contact | Toshiya Yamamoto
|
|---|
Publications
| Year | Publication |
|---|
| 2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
| 2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
| 2002 | Yamamoto T, Kimura T, Shoda M, Ban Y, Hayashi T, Matsuta N. Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes. 2002 Mar; 2(1):14-16. |
|
