|
Marker Overview
Name | NH002b |
Genbank ID | N/A |
Type | SSR |
Species | Pyrus pyrifolia |
Repeat Motif | (GA)12 |
PCR Condition | 50 |
Primer 1 | NH002b.forward primer: GGAGTCAGCGGCAAAAAAAG |
Primer 2 | NH002b.reverse primer: CCCACTCCCTCCTCTTATTGT |
Product Length | 180 |
Max Length | 185 bp |
Publication | [view all] |
Contact | Toshiya Yamamoto Miyuki Kunihisa
|
Publications
Year | Publication |
2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
2002 | Yamamoto T, Kimura T, Shoda M, Ban Y, Hayashi T, Matsuta N. Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes. 2002 Mar; 2(1):14-16. |
2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
|