|
|
Marker Overview
| Name | NH019b |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pyrus pyrifolia |
|---|
| Repeat Motif | (AG)18 |
|---|
| Primer 1 | NH019b.forward primer: gagatggagtagtaaagaagaagg |
|---|
| Primer 2 | NH019b.reverse primer: acgacatagtgaaaacagaag |
|---|
| Publication | [view all] |
|---|
| Contact | Toshiya Yamamoto
|
|---|
Publications
| Year | Publication |
|---|
| 2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
| 2002 | Yamamoto T, Kimura T, Shoda M, Imai T, Saito T, Sawamura Y, Kotobuki K, Hayashi T, Matsuta N. Genetic linkage maps constructed by using an interspecific cross between Japanese and European pears. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Dec; 106(1):9-18. |
|
