CO817853, CO817853 (genetic_marker) Fragaria ananassa | GDR

Marker Overview

Marker Overview


Name	CO817853
Genbank ID	N/A
Type	SSR
Species	Fragaria x ananassa
Repeat Motif	17mer
Primer 1	CO817853.Forward: CCATTCAAAACCTCCTCTTCC
Primer 2	CO817853.Reverse (no gttt): ATGGGTCCTTCGTCTGAGTG
Publication	[view all]
Contact	Eric van de Weg

Contact

Name

Details

Eric van de Weg

First name:	Eric
Last name:	van de Weg
Title:	researcher
Institution:	Wageningen-UR Plant Breeding, Wageningen University and Research Centre
Address:	P.O. Box 16, 6700 AA Wageningen, The Netherlands
Country:	The Netherlands
Email:	eric.vandeweg@wur.nl
Keywords:	allo-octoploid strawberry

Publications


Year	Publication
2008	Spigler RB, Lewers KS, Main DS, Ashman TL. Genetic mapping of sex determination in a wild strawberry, Fragaria virginiana, reveals earliest form of sex chromosome. Heredity. 2008 Dec; 101(6):507-517.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Fragaria-FVxFN-F2-2010	FG1	N/A	37.32	CO817853	View
2	Strawberry-HK-F1	LG1A	N/A	17.6	CO817853	View
3	Strawberry-HK-F1	LG1B	N/A	29.9	CO817853	View
4	Strawberry-HK-F1	LG1C	N/A	31.2	CO817853	View
5	Strawberry-HK-F1	LG1D	N/A	20.8	CO817853	View
6	Strawberry-High_Density_SSR_Map-F1	1A	N/A	44.65	CO817853	View
7	Strawberry-Reikou-S1	1A	N/A	65.43	CO817853	View
8	Strawberry-YO-F1-2008	LG2	N/A	83.8	CO817853_316	View
9	Strawberry-YO-F1-2008	LG25	N/A	44.7	CO817853_334	View
10	Strawberry-YO-F1-2008	LG25	N/A	48.7	CO817853_332	View
11	Strawberry-YO-F1-2008	LG28	N/A	31	CO817853_318d	View
12	Strawberry-YO-F1-2008	LG28	N/A	36.9	CO817853_314	View