CH04c06, CH04c06 (genetic_marker) Malus x domestica

Marker Overview
NameCH04c06
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH04c06.primer 1: GCTGCTGCTGCTTCTAGGTT
Primer 2CH04c06.primer 2: GCTTGGAAAAGGTCACTTGC
Product Length155-186
155–186
Max Length211 bp
PolymorphismP_ CH04c06
Publication[view all]
ContactC. Gessler
Zhen Han
Publications
YearPublication
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2013Lê Van A, Caffier V, Lasserre-Zuber P, Chauveau A, Brunel D, Le Cam B, Durel CE. Differential selection pressures exerted by host resistance quantitative trait loci on a pathogen population: a case study in an apple × Venturia inaequalis pathosystem. The New phytologist. 2013 Feb; 197(3):899-908.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH04c06.primer 1Malus x domesticaprimer
primer 2CH04c06.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH04C06_DTCH04C06_DTMalus x domesticamarker_locus
CH04c06CH04c06Malus x domesticamarker_locus
CH04c06yCH04c06yMalus x domesticamarker_locus
CH04c06.yCH04c06.yMalus x domesticamarker_locus
CH04c06CH04c06-97.677Malus x domesticamarker_locus
CH04c06CH04c06-207.309Malus x domesticamarker_locus
CH04c06CH04c06-152.493Malus x domesticamarker_locus
CH04c06CH04c06-2.6Malus x domesticamarker_locus
CH04c06CH04c06-40.01Malus x domesticamarker_locus
CH04c06CH04c06-12.55Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-DT-F1-2013LG17N/A5CH04C06_DTView
2Apple-DT-F117N/A5CH04c06View
3Apple Integrated map17N/A2CH04c06View
4Apple-JGD-F1-FRRG17N/A43.5CH04c06View
5Apple-X3259X3263-F117N/A0CH04c06View
6Apple-GDxJ-F1-2012LG17.1N/A32.1CH04c06View
7Apple-RGTxGD-F1-2015RGT_17N/A1.28CH04c06View
8Apple-RGTxGD-F1-2015GD_17N/A2.9CH04c06View
9Apple-RGxPI6-F1LG17N/A5.7CH04c06View
10Apple-JM7xS63-F1J17N/A0CH04c06View
11Apple-GDxBr-F1-2013LG17N/A1.46CH04c06View
12Pear-BD-F1-2014-geneticLG17N/A131.5CH04c06View
13Apple-FD-F1-2006F17N/A2.8CH04c06yView
14Apple-FD-F1-2006D17N/A0CH04c06yView
15Apple-IM-F1-IdaredIda LG 17N/A0CH04c06yView
16Apple-PF-F1-2012ch17N/A0CH04c06yView
17Apple-FD-Discovery-F1-2003D17N/A0CH04c06yView
18Apple-MM-F117N/A0CH04c06.yView
19Apple-M432-2012LG17N/A0CH04c06.yView
20Pear-Rcf-F1-femaleLG17N/A97.68CH04c06View
21Pear-M-F1-maleLG17N/A207.31CH04c06View
22Pear-RM-F1-IntegratedLG17N/A152.49CH04c06View
23Apple-JM7xS63-F1S17N/A2.6CH04c06View
24Pear-integrated_consensus_map-IPCG-2017LG17N/A40.01CH04c06View
25Pear-integrated_consensus_map-IPCG-2017LG10N/A12.55CH04c06View
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple