CH05d08, CH05d08 (genetic_marker) Malus x domestica

Marker Overview
NameCH05d08
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05D08.forward: TCATGGATGGGAAAAAGAGG
Primer 2CH05D08.reverse: TGATTGCCACATGTCAGTGTT
Primer 3CH05d08.primer 1: TCATGGATGGGAAAAAGAGG
Primer 4CH05d08.primer 2: TGATTGCCACATGTCAGTGTT
Product Length91-143
PolymorphismP_ CH05d08
Publication[view all]
ContactC. Gessler
Riccardo Velasco
CommentGenomic DNA was extracted from leaf tissue using Qiagen DNeasy 96 plant kits (QIAGEN GmbH, Hilden Germany). Sixteen SSR primers were selected for amplification based on previously published studies (Table 2; Liebhard et al. 2002; Yamamoto et al. 2002). The M13 primer, 5’ CACGACGTTGTAAAACGA 3’, with fluorescent dye label (6FAM, or VIC, or NED) was covalently bound to the 5’ end for detection on the ABI 3730 was synthetized from Applied Biosystems (Carlsbad, CA). The two unlabeled primers consisted of a specific SSR-targeting forward primer with a 5’ M13 tail and a specific SSR-targeting reverse primer was synthetized from Sangon Biotech (Shanghai, China). Amplification was carried out in two PCR cycles. The first PCR amplification was performed in a 10μl solution of 20 ng genomic DNA, 1×PCR buffer, 0.25 mM dNTP, 0.6 unit Taq DNA polymerase, 2 mM MgCl2, 0.24μM reverse primer, 0.24 μM forward primer with M13 tail. The first PCR amplification was performed under the following conditions: 94℃ (5 min), 35 cycles at 94℃(30 s)/annealing temperature (An.T) (30 s)/72℃ (45 s), and a final extension at 72℃ for 10 min. using the optimal annealing temperature for each locus (Table 2). The second amplification reaction was performed in a 12.1μl solution of 10μl PCR products of the first PCR circle, 0.3μM fluorescent labeled M13 primer, 0.1× supplied PCR buffer, 0.4 unit of Taq DNA polymerase. The conditions of the second PCR amplification were as follows: 94℃ (5 min), 16 cycles at 94℃ (30 s)/53℃(45 s)/72℃ (45 s), and a final extension at 72℃for10 min. The PCR products were cleaned with ethanol, and then denaturated at 94℃ for 5 min. Finally the fluorescent labeled PCR products at each locus were separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Carlsbad, CA).
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Riccardo Velasco
First name:Riccardo
Last name:Velasco
Title:researcher
Institution:IASMA Research and Innovation Centre
Address:Foundation Edmund Mach, Via E. Mach 1, 38010 San Michele all’Adige, Trento, Italy
Country:Italy
Email:riccardo.velasco@iasma.it
Keywords:Venturia inaequalis
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2013Lê Van A, Caffier V, Lasserre-Zuber P, Chauveau A, Brunel D, Le Cam B, Durel CE. Differential selection pressures exerted by host resistance quantitative trait loci on a pathogen population: a case study in an apple × Venturia inaequalis pathosystem. The New phytologist. 2013 Feb; 197(3):899-908.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015Cova V, Bandara NL, Liang W, Tartarini S, Patocchi A, Troggio M, Velasco R, Komjanc M. Fine mapping of the Rvi5 (Vm) apple scab resistance locus in the ‘Murray’ apple genotype. Molecular Breeding. 2015. 35: 200.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
2002R. Liebhard, L. Gianfranceschi, B. Koller, C.D. Ryder, R. Tarchini, E. Van De Weg, C. Gessler. Development and characterization of 140 new microsatellites in apple. Molecular Breeding December 2002, 10(4):217-241
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006D9N/A72.5CH05d08zView
2Apple-FD-F1-2006F17N/A64.4CH05d08yView
3Apple-FD-F1-2006D17N/A90.9CH05d08yView
4Apple-RGxPI6-F1LG17N/A87.9CH05d08yView
5Apple-DT-F117N/A72CH05d08View
6Apple-GaxDR-F1LG17N/A60.4CH05d08View
7Apple-SExA-F1-consensusLG9N/A94.1CH05d08View
8Apple Integrated map17N/A72.6CH05d08View
9Apple-PF-F1-2012ch17N/A77CH05d08View
10Apple-GDxM-F1LG17N/A34.3CH05d08View
11Apple-X3259X3263-F117N/A85.5CH05d08View
12Apple-JG-F1LG9N/A0CH05d08View
13Apple-JGxWSH-F1LG9N/A0CH05d08View
14Apple-DT-F1-2013LG17N/A72CH05D08_DTView
15Apple-MM-F117N/A57.3CH05d08.yView
16Apple-M432-2012LG17N/A60.9CH05d08.yView