|
|
Marker Overview
| Name | NZ28f4 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | (ga)18 |
|---|
| Primer 1 | NZ28f4.forward primer: tgcctcccttatatagctac |
|---|
| Primer 2 | NZ28f4.reverse primer: tga gga cgg tga gat ttg |
|---|
| Product Length | 112 |
|---|
| Publication | [view all] |
|---|
| Contact | P. Guilford
|
|---|
Publications
| Year | Publication |
|---|
| 2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
| 2012 | Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660 |
| 1997 | Guilford P, Prakash S, Zhu JM, Rikkerink E, Gardiner S, Bassett H, Forster R. Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics. 1997; 94(2):249-254. |
|
