|
|
Marker Overview
| Name | NZ02b1 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | (ga)14 |
|---|
| Primer 1 | NZ02b1.forward primer: ccgtgatgacaaagtgcatga |
|---|
| Primer 2 | NZ02b1.reverse primer: atg agt ttg atg ccc ttg ga |
|---|
| Product Length | 238 |
|---|
| Publication | [view all] |
|---|
| Contact | P. Guilford
|
|---|
Publications
| Year | Publication |
|---|
| 2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
| 1997 | Guilford P, Prakash S, Zhu JM, Rikkerink E, Gardiner S, Bassett H, Forster R. Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics. 1997; 94(2):249-254. |
| 2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
|
