|
|
Marker Overview
| Name | CH01b09b |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | GA |
|---|
| PCR Condition | annealing temp 60 degree |
|---|
| Primer 1 | CH01b09b.primer 1: TTATAGCAGCAACAGGAGCG |
|---|
| Primer 2 | CH01b09b.primer 2: TATTCGGGAGGCATGGTATG |
|---|
| Product Length | 172-182 |
|---|
| Polymorphism | P_ CH01b09b |
|---|
| Publication | [view all] |
|---|
| Contact | C. Gessler
Zhen Han
|
|---|
Publications
| Year | Publication |
|---|
| 2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
| 2015 | Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53. |
|
