CH02b10, CH02b10 (genetic_marker) Malus x domestica

Marker Overview
NameCH02b10
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(GA)19, 5
PCR Condition
Primer 1CH02B10.F: CAAGGAAATCATCAAAGATTCAAG
Primer 2CH02B10.R: CAAGTGGCTTCGGATAGTTG
Product Length121–159
Max Length135 bp
PolymorphismP_ CH02b10
Publication[view all]
ContactMiyuki Kunihisa
Zhen Han
C. Gessler
Publications
YearPublication
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
1998Theoretical and applied genetics. Theor. appl. genet. June 1998. v. 96 (8) p. 1069-1076. ISSN 0040-5752; THAGA6
2006J. Amer. Soc. Hort. Sci. 131:408-417
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
FCH02B10.FMalus x domesticaprimer
RCH02B10.RMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH02b10CH02b10Malus x domesticamarker_locus
CH02b10CH02b10-47.7Malus x domesticamarker_locus
CH02b10CH02b10-41.6Malus x domesticamarker_locus
CH02b10CH02b10-88.8Malus x domesticamarker_locus
CH02b10CH02b10-129.16Malus x domesticamarker_locus
CH02B10CH02B10-47.5Malus x domesticamarker_locus
CH02B10CH02B10-89.016Malus x domesticamarker_locus
CH02B10CH02B10-89.382Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-C16xC17-F1-20122N/A56.22CH02b10View
2Pear-BH-F1Ba2N/A47.1CH02b10View
3Pear-BH-F1Ho2N/A23.6CH02b10View
4Apple-FD-F1-2006F2N/A51.3CH02b10View
5Apple Integrated map2N/A63.2CH02b10View
6Apple-MAL0045_x_Idared-F1-MfuscaLG2AN/A13.2CH02b10View
7Pear-PM-F1-PEAR32N/A52.29CH02b10View
8Pear-PM-F1-Moonglow2N/A43.7CH02b10View
9Apple-2000-2012-F1ch6N/A40CH02b10View
10Apple-OA-F1-OrinOR2N/A48.4CH02b10View
11Apple-OA-F1-AkaneAK2N/A48.8CH02b10View
12Apple-JGD-F1-BotcankerJ2N/A55.1CH02b10View
13Apple-X3259X3263-F12N/A63.3CH02b10View
14Apple-GDxJ-F1-2012LG2N/A61.4CH02b10View
15Apple-JGD-F1-2014G2N/A61.8CH02b10View
16Apple-RGTxGD-F1-2015RGT_2N/A48.19CH02b10View
17Apple-RGTxGD-F1-2015GD_2N/A51.69CH02b10View
18Apple-FD-F1-2013LG2N/A70CH02b10View
19Apple-FjxPL-F1-2013LG2N/A50CH02b10View
20Pear-Bartlett-F1-2007Ba2N/A43.2CH02b10View
21Pear-La_France-F1-2007La2N/A45.9CH02b10View
22Apple-FD-Discovery-F1-2003D2N/A42.2CH02b10View
23Apple-JM7xS63-F1S2N/A47.7CH02b10View
24Pear-Ba-F1-2013Ba2N/A41.6CH02b10View
25Pear-BD-F1-2015LG2N/A88.8CH02b10View
26Pear-integrated_consensus_map-IPCG-2017LG2N/A129.16CH02b10View
27Apple-JM7xS63-F1J2N/A47.5CH02B10View
28Pear-Bayuehong-F1-2015LG2N/A89.02CH02B10View
29Pear-Dangshansuli-F1-2015LG2N/A89.38CH02B10View
Contact
NameDetails
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002