CH02c11, CH02c11 (genetic_marker) Malus x domestica

Marker Overview
NameCH02c11
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Condition94 °C for 5 min, 35x (94 °C for 60 s, 55 °C for 60 s, 72 °C for 60 s), 72°C for 10 min
annealing temp 60 degree
Primer 1CH02c11-Forward: TGAAGGCAATCACTCTGTGC
Primer 2CH02c11-Reverse: TTCCGAGAATCCTCTTCGAC
Primer 3CH02c11.primer 1: TGAAGGCAATCACTCTGTGC
Primer 4CH02c11.primer 2: TTCCGAGAATCCTCTTCGAC
Product Length235-243
219-239
Max Length243
PolymorphismP_ CH02c11
Publication[view all]
ContactC. Gessler
Andreas Peil
Miyuki Kunihisa
Publications
YearPublication
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH02c11.primer 1Malus x domesticaprimer
primer 2CH02c11.primer 2Malus x domesticaprimer
CH02c11-ForwardMalus x domesticaprimer
CH02c11-ReverseMalus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
phenolic compound contentqPHE.X5210X8402-LG10.J09.quercitrinMalus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH02c11CH02c11Malus x domesticamarker_locus
CH02c11CH02c11-67.7Malus x domesticamarker_locus
CH02c11CH02c11-4.7Malus x domesticamarker_locus
CH02c11CH02c11-19.1Malus x domesticamarker_locus
CH02c11CH02c11-30.2Malus x domesticamarker_locus
CH02c11CH02c11-3Malus x domesticamarker_locus
CH02c11CH02c11-112.393Malus x domesticamarker_locus
CH02c11CH02c11-106.766Malus x domesticamarker_locus
CH02c11CH02c11-35.3Malus x domesticamarker_locus
CH02c11CH02c11-39.1Malus x domesticamarker_locus
CH02c11CH02c11-40.088Malus x domesticamarker_locus
CH02c11CH02c11-41.21Malus x domesticamarker_locus
CH02c11CH02c11-112.53Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-C16xC17-F1-201210N/A64.94CH02c11View
2Apple Integrated map10N/A38.3CH02c11View
3Pear-BH-F1Ho10N/A32.4CH02c11View
4Pear-BH-F1Ba10N/A46.8CH02c11View
5Apple-FD-F1-2006D10N/A39.9CH02c11View
6Apple-FD-F1-2006F10N/A38.1CH02c11View
7Apple-IM-F1-IdaredIda LG 10N/A38.8CH02c11View
8Apple-IM-F1-Mr5Mr5 LG 10N/A34.6CH02c11View
9Apple-MAL0045_x_Idared-F1-MfuscaLG10N/A22.2CH02c11View
10Apple-2000-2012-F1ch10N/A51CH02c11View
11Apple-PF-F1-2012ch10N/A44CH02c11View
12Apple-MM-F110N/A40.9CH02c11View
13Apple-OA-F1-OrinOR10N/A39CH02c11View
14Apple-OA-F1-AkaneAK10N/A31.9CH02c11View
15Apple-X3259X3263-F110N/A41.74CH02c11View
16Apple-GDxJ-F1-2012LG10N/A43.8CH02c11View
17Apple-M432-2012LG10N/A38.8CH02c11View
18Apple-RGTxGD-F1-2015RGT_10N/A38.64CH02c11View
19Apple-RGTxGD-F1-2015GD_10N/A58.02CH02c11View
20Apple-X5210X8402-F1-X5210LG10N/A27.6CH02c11View
21Apple-X5210X8402-F1-X8402LG10N/A45.6CH02c11View
22Apple-FjxPL-F1-2013LG10N/A39.79CH02c11View
23Pear-BD-F1-2014-geneticLG10N/A65CH02c11View
24Pear-Bartlett-F1-2007Ba10N/A41.8CH02c11View
25Pear-La_France-F1-2007La10N/A43.3CH02c11View
26Apple-FD-Discovery-F1-2003D10N/A46.4CH02c11View
27Rose-82-1134-F2LG04N/A67.7CH02c11View
28Rose-82-1134-F2LG09N/A4.7CH02c11View
29Rose-86-7-F2LG07N/A19.1CH02c11View
30Rose-86-7-F2LG14N/A30.2CH02c11View
31Rose-H190-F1A7N/A3CH02c11View
32Pear-M-F1-maleLG10N/A112.39CH02c11View
33Pear-RM-F1-IntegratedLG10N/A106.77CH02c11View
34Pear-Ba-F1-2013Ba10N/A35.3CH02c11View
35Pear-BD-F1-2015LG10N/A39.1CH02c11View
36Pear-Bayuehong-F1-2015LG10N/A40.09CH02c11View
37Pear-Dangshansuli-F1-2015LG10N/A41.21CH02c11View
38Pear-integrated_consensus_map-IPCG-2017LG10N/A112.53CH02c11View