|
Marker Overview
Name | CH04c10 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | GA |
PCR Condition | annealing temp 60 degree |
Primer 1 | CH04c10.primer 1: GGGTTAGGTTGTCTTCTCTCCT |
Primer 2 | CH04c10.primer 2: GCTTCTCGGGTGAGTTTTTC |
Product Length | 133-180 133–180 |
Max Length | 145 bp |
Polymorphism | P_ CH04c10 |
Publication | [view all] |
Contact | C. Gessler Zhen Han
|
Publications
Year | Publication |
2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
2012 | Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660 |
2015 | Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53. |
|