CH05g01, CH05g01 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	CH05g01
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	GA
PCR Condition	annealing temp 60 degree
Primer 1	CH05g01.primer 1: TTTCATTCAACTTCACCTCTC
Primer 2	CH05g01.primer 2: CTCCTTTCCGATTCTTCTATTTCA
Product Length	236-276
Polymorphism	P_ CH05g01
Publication	[view all]
Contact	C. Gessler

Contact

Name

Details

C. Gessler

First name:	Cesare
Last name:	Gessler
Institution:	ETH Zurich
Address:	ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:	Switzerland
Email:	cesare.gessler@agrl.ethz.ch
Phone:	+41 44 632 38 71
Fax:	+41 (0) 632 11 08
Last update:	May 2002

Publications


Year	Publication
2002	Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-C16xC17-F1-2012	11	N/A	30.38	CH05g01	View
2	Apple-MM-F1	11	N/A	33.2	CH05g01	View
3	Apple-M432-2012	LG11	N/A	38.2	CH05g01	View
4	Apple-JM7xS63-F1	J11	N/A	19.1	CH05g01	View
5	Apple-JM7xS63-F1	S11	N/A	16.1	CH05g01	View

Alignments

Feature Name	Type	Location	Analysis
Chr11	chromosome	Chr11:10604201..10604513.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr11A	chromosome	chr11A:9742773..9743020.	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation