|
|
Marker Overview
| Name | CH05g02 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | GA |
|---|
| PCR Condition | annealing temp 60 degree |
|---|
| Primer 1 | CH05g02.primer 1: AGTGCAGCTTTCAGCTCAGATT |
|---|
| Primer 2 | CH05g02.primer 2: AGTCAGACACACCAAAATCCCT |
|---|
| Product Length | 135-145 |
|---|
| Polymorphism | P_ CH05g02 |
|---|
| Publication | [view all] |
|---|
| Contact | C. Gessler
|
|---|
Publications
| Year | Publication |
|---|
| 2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
| 2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
|
