|
|
Marker Overview
| Name | GD100 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | (GA)12 |
|---|
| PCR Condition | Two multiplexed primer sets, GD 12, 15 and 96 and GD100 and 103, were amplified in 25-microliter mixtures containing 25 ng of genomic DNA, 10-45 pmol of each primer, 0.20 mM of dNTPs, 2.0 mM MgSO4, 1 X buffer, and 0.25 units of polymerase. The multiplexed primer set GD142, 147 and 162 was amplified in a 20-microliter mixture containing 30 ng of genomic DNA, 20 pmols of each primer pair, same as above for dNTPs and MgSO4, 1 X buffer and 0.20 units polymerase. Multiplex primer set GD 142, 147 and 162 was amplified using a touchdown. Initially, 2 min at 94 degree followed by 2 cycles of 94C for 60 s, 65C 30 s, and 72C for 45s. The following 18 cycles had an annealing temp reduced by 1 degree per 2 cycles. The last 5 cycles maintained the 55C annealing temperature. The multiplex primer sets GD 12, GD 15, GD 96 and GD 100 and GD 103 were amplified following a 4-min denaturation at 94C . Reaction conditions were 25 cycles at 94C for 60s, 55C for 120s, 72C for 120s and a 10m extension at 72C. |
|---|
| Primer 1 | GD100.F: ACAGCAAGGTGTTGGGTAAGAAGGT |
|---|
| Primer 2 | GD100.R: TGCGGACAAAGGAAAAAAAAAAGTG |
|---|
| Product Length | 223-242 |
|---|
| Max Length | 242 |
|---|
| Polymorphism | P_ GD100 |
|---|
| Publication | [view all] |
|---|
| Contact | S. Hokanson
|
|---|
|
