Hi03b03, Hi03b03 (genetic_marker) Malus x domestica

Marker Overview
NameHi03b03
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi03b03.primer 1: TGAATTGAGTTTGAGAATGGAATG
Primer 2Hi03b03.primer 2: GTTTGTCAGGACGGGTAATCAAGG
Product Length196-212
PolymorphismP_ Hi03b03
Publication[view all]
ContactA. Patocchi
Miyuki Kunihisa
Zhen Han
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53.
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi03b03.primer 1Malus x domesticaprimer
primer 2Hi03b03.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi03b03Hi03b03Malus x domesticamarker_locus
Hi03b03Hi03b03-49.5Malus x domesticamarker_locus
Hi03b03-m1Hi03b03-m1-43.2Malus x domesticamarker_locus
Hi03b03Hi03b03-136.17Malus x domesticamarker_locus
Hi03b03Hi03b03-109.25Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-C16xC17-F1-201212N/A35.87Hi03b03View
2Apple Integrated map12N/A30.7Hi03b03View
3Apple-FD-F1-2006F12N/A46.7Hi03b03View
4Apple-OA-F1-OrinOR12N/A42Hi03b03View
5Apple-OA-F1-AkaneAK12N/A26.3Hi03b03View
6Apple-JGD-F1-FRRJ12N/A62.1Hi03b03View
7Apple-RGTxGD-F1-2015RGT_12N/A33.4Hi03b03View
8Apple-RGTxGD-F1-2015GD_12N/A37.72Hi03b03View
9Apple-GDxBr-F1-2013LG12N/A22.3Hi03b03View
10Pear-Ba-F1-2013Ba9N/A49.5Hi03b03View
11Pear-Ba-F1-2013Ba12N/A43.2Hi03b03-m1View
12Pear-integrated_consensus_map-IPCG-2017LG12N/A136.17Hi03b03View
13Pear-integrated_consensus_map-IPCG-2017LG9N/A109.25Hi03b03View
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple