|
|
Marker Overview
| Name | Hi03e03 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | GA |
|---|
| PCR Condition | annealing temp 60 degree |
|---|
| Primer 1 | Hi03e03.primer 1: ACGGGTGAGACTCCTTGTTG |
|---|
| Primer 2 | Hi03e03.primer 2: GTTTAACAGCGGGAGATCAAGAAC |
|---|
| Product Length | 186-200 |
|---|
| Polymorphism | P_ Hi03e03 |
|---|
| Publication | [view all] |
|---|
| Contact | A. Patocchi
|
|---|
Publications
| Year | Publication |
|---|
| 2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
|
