CH01F07A, CH01F07A (genetic_marker) Malus x domestica

Marker Overview
NameCH01F07A
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR ConditionPCR in 15 ul total volume with 10-50 ng DNA template and 0.3 to 0.7 pM of primers combined with 1.5 unites Taq Polymerase (Promega, Madison, Wis.), 1x Promega magnesium free buffer, 0.25 mM MgCl2, adn 0.25 mM dNTP (Promega). PCR amplifications were carried out using a PTC200 thermocycler (MJ Research, Reno, Nev.). The PCR proram had an initial denaturation step of 2 min at 95C followed by 30 cycles of 30 s at 95C, 30 s at 58C, 15 s at 72 C adn ending with a final extension step of 2 min at 72C. PCR rxn were diluted 1:1 in 95% formamide, 50 mM EDTA bromophenol blue loading dye, adn denatured at 95C for 3 min.
Primer 1CH01F07A.Forward: CCCTACACAGTTTCTCAACCC
Primer 2CH01F07A.Reverse: CGTTTTTGGAGCGTAGGAAC
Product Length174-206
PolymorphismP_ CH01F07A
Publication[view all]
ContactC. Gessler
CommentGenomic DNA was extracted from leaf tissue using Qiagen DNeasy 96 plant kits (QIAGEN GmbH, Hilden Germany). Sixteen SSR primers were selected for amplification based on previously published studies (Table 2; Liebhard et al. 2002; Yamamoto et al. 2002). The M13 primer, 5’ CACGACGTTGTAAAACGA 3’, with fluorescent dye label (6FAM, or VIC, or NED) was covalently bound to the 5’ end for detection on the ABI 3730 was synthetized from Applied Biosystems (Carlsbad, CA). The two unlabeled primers consisted of a specific SSR-targeting forward primer with a 5’ M13 tail and a specific SSR-targeting reverse primer was synthetized from Sangon Biotech (Shanghai, China). Amplification was carried out in two PCR cycles. The first PCR amplification was performed in a 10μl solution of 20 ng genomic DNA, 1×PCR buffer, 0.25 mM dNTP, 0.6 unit Taq DNA polymerase, 2 mM MgCl2, 0.24μM reverse primer, 0.24 μM forward primer with M13 tail. The first PCR amplification was performed under the following conditions: 94℃ (5 min), 35 cycles at 94℃(30 s)/annealing temperature (An.T) (30 s)/72℃ (45 s), and a final extension at 72℃ for 10 min. using the optimal annealing temperature for each locus (Table 2). The second amplification reaction was performed in a 12.1μl solution of 10μl PCR products of the first PCR circle, 0.3μM fluorescent labeled M13 primer, 0.1× supplied PCR buffer, 0.4 unit of Taq DNA polymerase. The conditions of the second PCR amplification were as follows: 94℃ (5 min), 16 cycles at 94℃ (30 s)/53℃(45 s)/72℃ (45 s), and a final extension at 72℃for10 min. The PCR products were cleaned with ethanol, and then denaturated at 94℃ for 5 min. Finally the fluorescent labeled PCR products at each locus were separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Carlsbad, CA).
Publications
YearPublication
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006J. Amer. Soc. Hort. Sci. 131:408-417
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2002R. Liebhard, L. Gianfranceschi, B. Koller, C.D. Ryder, R. Tarchini, E. Van De Weg, C. Gessler. Development and characterization of 140 new microsatellites in apple. Molecular Breeding December 2002, 10(4):217-241
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardCH01F07A.ForwardMalus x domesticaprimer
ReverseCH01F07A.ReverseMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH01f07aCH01f07aMalus x domesticamarker_locus
CH01F07ACH01F07A-57Malus x domesticamarker_locus
CH01F07ACH01F07A-89.4Malus x domesticamarker_locus
CH01F07ACH01F07A-91.351Malus x domesticamarker_locus
CH01F07ACH01F07A-99.26Malus x domesticamarker_locus
CH01F07ACH01F07A-192.25Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-BH-F1Ho10N/A62.9CH01f07aView
2Apple Integrated map10N/A71.6CH01f07aView
3Apple-MM-F110N/A71.6CH01f07aView
4Apple-M432-2012LG10N/A69.8CH01f07aView
5Pear-Bartlett-F1-2007Ba10N/A62.9CH01f07aView
6Pear-La_France-F1-2007La10N/A69.2CH01f07aView
7Apple-FD-Discovery-F1-2003D10N/A87.3CH01f07aView
8Pear-Ba-F1-2013Ba10N/A57CH01F07AView
9Pear-BD-F1-2015LG10N/A89.4CH01F07AView
10Pear-Bayuehong-F1-2015LG10N/A91.35CH01F07AView
11Pear-Dangshansuli-F1-2015LG10N/A99.26CH01F07AView
12Pear-integrated_consensus_map-IPCG-2017LG10N/A192.25CH01F07AView