AT000174-SSR, AT000174-SSR (genetic_marker) Malus x domestica

Marker Overview
NameAT000174-SSR
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifTA-GTA-GT
PCR Conditionannealing temp 60 degree
Primer 1AT000174-SSR.primer 1: CGGAGGCCGCTATAATTAGG
Primer 2AT000174-SSR.primer 2: CCTGGAAAGAAAGTAAAAGGACA
Product Length178-200
PolymorphismP_ AT000174-SSR
Publication[view all]
ContactA. Patocchi
Zhen Han
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2015Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53.
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1AT000174-SSR.primer 1Malus x domesticaprimer
primer 2AT000174-SSR.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AT000174-ssrAT000174-ssrMalus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map17N/A12.4AT000174-ssrView
2Apple-FD-F1-2006F17N/A6.8AT000174-ssrView
3Apple-FD-F1-2006D17N/A11.8AT000174-ssrView
4Apple-JGD-F1-BotcankerG17N/A62.8AT000174-ssrView
5Apple-JGD-F1-FRRG17N/A16.1AT000174-ssrView
6Apple-JGD-F1-FRRJ17N/A0AT000174-ssrView
7Apple-GDxJ-F1-2012LG17.1N/A16.1AT000174-ssrView
8Apple-RGTxGD-F1-2015RGT_17N/A2.61AT000174-ssrView
9Apple-RGTxGD-F1-2015GD_17N/A14.25AT000174-ssrView
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple