CH01f03b, CH01f03b (genetic_marker) Malus x domestica

Marker Overview
NameCH01f03b
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH01f03b.forward: CAC GAC GTT GTA AAA CGA CGAG AAG CAA ATG CAA AAC CC
Primer 2CH01f03b.primer 1: GAGAAGCAAATGCAAAACCC
Primer 3CH01f03b.primer 2: CTCCCCGGCTCCTATTCTAC
Primer 4CH01f03b.reverse: CTC CCC GGC TCC TAT TCT AC
Product Length139-183
PolymorphismP_ CH01f03b
Publication[view all]
ContactC. Gessler
Andreas Peil
Miyuki Kunihisa
CommentGenomic DNA was extracted from leaf tissue using Qiagen DNeasy 96 plant kits (QIAGEN GmbH, Hilden Germany). Sixteen SSR primers were selected for amplification based on previously published studies (Table 2; Liebhard et al. 2002; Yamamoto et al. 2002). The M13 primer, 5’ CACGACGTTGTAAAACGA 3’, with fluorescent dye label (6FAM, or VIC, or NED) was covalently bound to the 5’ end for detection on the ABI 3730 was synthetized from Applied Biosystems (Carlsbad, CA). The two unlabeled primers consisted of a specific SSR-targeting forward primer with a 5’ M13 tail and a specific SSR-targeting reverse primer was synthetized from Sangon Biotech (Shanghai, China). Amplification was carried out in two PCR cycles. The first PCR amplification was performed in a 10μl solution of 20 ng genomic DNA, 1×PCR buffer, 0.25 mM dNTP, 0.6 unit Taq DNA polymerase, 2 mM MgCl2, 0.24μM reverse primer, 0.24 μM forward primer with M13 tail. The first PCR amplification was performed under the following conditions: 94℃ (5 min), 35 cycles at 94℃(30 s)/annealing temperature (An.T) (30 s)/72℃ (45 s), and a final extension at 72℃ for 10 min. using the optimal annealing temperature for each locus (Table 2). The second amplification reaction was performed in a 12.1μl solution of 10μl PCR products of the first PCR circle, 0.3μM fluorescent labeled M13 primer, 0.1× supplied PCR buffer, 0.4 unit of Taq DNA polymerase. The conditions of the second PCR amplification were as follows: 94℃ (5 min), 16 cycles at 94℃ (30 s)/53℃(45 s)/72℃ (45 s), and a final extension at 72℃for10 min. The PCR products were cleaned with ethanol, and then denaturated at 94℃ for 5 min. Finally the fluorescent labeled PCR products at each locus were separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Carlsbad, CA).
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Publications
YearPublication
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
2002R. Liebhard, L. Gianfranceschi, B. Koller, C.D. Ryder, R. Tarchini, E. Van De Weg, C. Gessler. Development and characterization of 140 new microsatellites in apple. Molecular Breeding December 2002, 10(4):217-241
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map9N/A31.1CH01f03bView
2Apple-IM-F1-IdaredIda LG 9N/A38.8CH01f03bView
3Apple-MAL0045_x_Idared-F1-MfuscaLG9N/A45.2CH01f03bView
4Apple-MM-F19N/A28.7CH01f03bView
5Apple-OA-F1-OrinOR9N/A24.6CH01f03bView
6Apple-OA-F1-AkaneAK9N/A34.6CH01f03bView
7Apple-X3259X3263-F19N/A22.94CH01f03bView
8Apple-M432-2012LG9N/A24.8CH01f03bView
9Apple-DP-F1-2013D9N/A25.4CH01f03bView
10Apple-DP-F1-2013P9N/A25.8CH01f03bView
11Apple-X5210X8402-F1-X5210LG9N/A0CH01f03bView
12Apple-X5210X8402-F1-X8402LG9N/A26CH01f03bView
13Apple-FjxPL-F1-2013LG9N/A25.92CH01f03bView
14Pear-La_France-F1-2007La9N/A17.8CH01f03bView
15Apple-FD-Discovery-F1-2003D9N/A23.9CH01f03bView
16Pear-BD-F1-2015LG9N/A74.4CH01f03bView
17Pear-Bayuehong-F1-2015LG9N/A68.69CH01f03bView
18Pear-Dangshansuli-F1-2015LG9N/A74.11CH01f03bView
19Pear-integrated_consensus_map-IPCG-2017LG9N/A73.46CH01f03bView
20Apple-JM7xS63-F1J9N/A23.1CH01f03bView