|
Marker Overview
Name | CH01g05 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | GA |
PCR Condition | annealing temp 60 degree |
Primer 1 | CH01g05.primer 1: CATCAGTCTCTTGCACTGGAAA |
Primer 2 | CH01g05.primer 2: GACAGAGTAAGCTAGGGCTAGGG |
Product Length | 140-188 140–188 |
Max Length | 151 bp |
Polymorphism | P_ CH01g05 |
Publication | [view all] |
Contact | C. Gessler Miyuki Kunihisa Zhen Han
|
Publications
Year | Publication |
2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
2010 | Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839. |
2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
2013 | Lê Van A, Caffier V, Lasserre-Zuber P, Chauveau A, Brunel D, Le Cam B, Durel CE. Differential selection pressures exerted by host resistance quantitative trait loci on a pathogen population: a case study in an apple × Venturia inaequalis pathosystem. The New phytologist. 2013 Feb; 197(3):899-908. |
2012 | Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660 |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
2015 | Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53. |
2015 | Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119 |
2004 | Plant Breeding, 123(4):321 |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
This genetic_marker is adjacent to the following QTL feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
|