CH02a04, CH02a04 (genetic_marker) Malus x domestica

Marker Overview
NameCH02a04
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH02a04.forward: CAC GAC GTT GTA AAA CGA CGAA ACA GGC GCC ATT ATT TG
Primer 2CH02a04.primer 1: GAAACAGGCGCCATTATTTG
Primer 3CH02a04.primer 2: AAAGGAGACGTTGCAAGTGG
Primer 4CH02a04.reverse: AAA GGA GAC GTT GCA AGT GG
Product Length66-112
PolymorphismP_ CH02a04
Publication[view all]
ContactC. Gessler
CommentGenomic DNA was extracted from leaf tissue using Qiagen DNeasy 96 plant kits (QIAGEN GmbH, Hilden Germany). Sixteen SSR primers were selected for amplification based on previously published studies (Table 2; Liebhard et al. 2002; Yamamoto et al. 2002). The M13 primer, 5’ CACGACGTTGTAAAACGA 3’, with fluorescent dye label (6FAM, or VIC, or NED) was covalently bound to the 5’ end for detection on the ABI 3730 was synthetized from Applied Biosystems (Carlsbad, CA). The two unlabeled primers consisted of a specific SSR-targeting forward primer with a 5’ M13 tail and a specific SSR-targeting reverse primer was synthetized from Sangon Biotech (Shanghai, China). Amplification was carried out in two PCR cycles. The first PCR amplification was performed in a 10μl solution of 20 ng genomic DNA, 1×PCR buffer, 0.25 mM dNTP, 0.6 unit Taq DNA polymerase, 2 mM MgCl2, 0.24μM reverse primer, 0.24 μM forward primer with M13 tail. The first PCR amplification was performed under the following conditions: 94℃ (5 min), 35 cycles at 94℃(30 s)/annealing temperature (An.T) (30 s)/72℃ (45 s), and a final extension at 72℃ for 10 min. using the optimal annealing temperature for each locus (Table 2). The second amplification reaction was performed in a 12.1μl solution of 10μl PCR products of the first PCR circle, 0.3μM fluorescent labeled M13 primer, 0.1× supplied PCR buffer, 0.4 unit of Taq DNA polymerase. The conditions of the second PCR amplification were as follows: 94℃ (5 min), 16 cycles at 94℃ (30 s)/53℃(45 s)/72℃ (45 s), and a final extension at 72℃for10 min. The PCR products were cleaned with ethanol, and then denaturated at 94℃ for 5 min. Finally the fluorescent labeled PCR products at each locus were separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Carlsbad, CA).
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Publications
YearPublication
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
2002R. Liebhard, L. Gianfranceschi, B. Koller, C.D. Ryder, R. Tarchini, E. Van De Weg, C. Gessler. Development and characterization of 140 new microsatellites in apple. Molecular Breeding December 2002, 10(4):217-241
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006D7N/A28.3CH02a04zView
2Apple-FD-F1-2006F7N/A18CH02a04zView
3Apple Integrated map7N/A28.3CH02a04zView
4Apple Integrated map2N/A63.2CH02a04yView
5Apple-FD-F1-2006F2N/A51.3CH02a04yView
6Apple-IM-F1-IdaredIda LG 2N/A76.5CH02a04yView
7Apple-PF-F1-2012ch2N/A55CH02a04yView
8Apple-GDxJ-F1-2012LG2N/A64.8CH02a04yView
9Apple-JGD-F1-2014G2N/A64.8CH02a04yView
10Apple-FD-F1-2013LG2N/A69.9CH02a04yView
11Apple-JGxWSH-F1LG2N/A86.9CH02a04yView
12Apple-WSH-F1LG2N/A95.3CH02a04yView
13Apple-MAL0045_x_Idared-F1-MfuscaLG2AN/A13.8CH02a04View
14Apple-MM-F12N/A57.9CH02a04View
15Apple-X3259X3263-F12N/A64.37CH02a04View
16Apple-M432-2012LG2N/A54.1CH02a04View
17Apple-RGxPI6-F1LG2N/A74.3CH02a04View
18Apple-RGxPI6-F1LG5N/A96.4CH02a04View
19Apple-FjxPL-F1-2013LG2N/A49.52CH02a04View
20Pear-La_France-F1-2007La2N/A45.9CH02a04View
21Pear-integrated_consensus_map-IPCG-2017LG2N/A129.16CH02a04View
22Pear-Rcf-F1-femaleLG2N/A61.12CH02a04View
23Pear-M-F1-maleLG2N/A66.25CH02a04View
24Pear-RM-F1-IntegratedLG2N/A66.09CH02a04View