CH02a08, CH02a08 (genetic_marker) Malus x domestica

Marker Overview
NameCH02a08
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH02a08.primer 1: GAGGAGCTGAAGCAGCAGAG
Primer 2CH02a08.primer 2: ATGCCAACAAAAGCATAGCC
Product Length133-177
PolymorphismP_ CH02a08
Publication[view all]
ContactC. Gessler
Felicidad Fernandez-Fernandez
R. Liebhard
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Felicidad Fernandez-Fernandez
First name:Felicidad
Last name:Fernandez-Fernandez
Title:Researcher
Institution:East Malling Research
Address:East Malling Research (EMR), New Road, East Malling, Kent ME19 6BJ, UK
Country:United Kingdoms
Email:felicidad.fernandez@emr.ac.uk
Fax:+44 1732 849067
Last update:Mar 2006
R. Liebhard
First name:R.
Last name:Liebhard
Institution:Swiss Federal Institute of Technology
Address:Swiss Federal Institute of Technology, Institute of Plant Science / Phytopathology, Universitätstrasse 2, 8092 Zurich, Switzerland
Country:Switzerland
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH02a08.primer 1Malus x domesticaprimer
primer 2CH02a08.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
catechin contentqCAT.X5210X8402-LG10.J10Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG10.J09.procyanidinB1Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH02a08CH02a08Malus x domesticamarker_locus
CH02a08zCH02a08zMalus x domesticamarker_locus
CH02a08yCH02a08yMalus x domesticamarker_locus
CH02a08.wCH02a08.wMalus x domesticamarker_locus
CH02a08.zCH02a08.zMalus x domesticamarker_locus
CH02a08.yCH02a08.yMalus x domesticamarker_locus
CH02a08CH02a08-64.6Malus x domesticamarker_locus
CH02a08CH02a08-62.6Malus x domesticamarker_locus
CH02a08CH02a08-9.9Malus x domesticamarker_locus
CH02a08.xCH02a08.xMalus x domesticamarker_locus
CH02a08CH02a08-46.9Malus x domesticamarker_locus
CH02a08CH02a08-8.2Malus x domesticamarker_locus
CH02a08CH02a08-21Malus x domesticamarker_locus
CH02a08CH02a08-43.684Malus x domesticamarker_locus
CH02a08CH02a08-92.94Malus x domesticamarker_locus
CH02a08CH02a08-20.78Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-X3259X3263-F110N/A17.12CH02a08View
2Apple-X5210X8402-F1-X5210LG10N/A12.1CH02a08View
3Apple-X5210X8402-F1-X8402LG10N/A21.3CH02a08View
4Pear-BD-F1-2014-geneticLG10N/A142.1CH02a08View
5Pear-Bartlett-F1-2007Ba5N/A50.6CH02a08View
6Pear-Bartlett-F1-2007Ba10N/A15.6CH02a08View
7Pear-La_France-F1-2007La5N/A66CH02a08View
8Pear-La_France-F1-2007La10N/A13.9CH02a08View
9Apple Integrated map5N/A85.1CH02a08zView
10Apple-FD-F1-2006D5N/A91.1CH02a08zView
11Apple-FD-F1-2006F5N/A55CH02a08zView
12Apple-FD-F1-2006F10N/A24.9CH02a08yView
13Apple-FD-F1-2006D10N/A23.2CH02a08yView
14Apple Integrated map10N/A19.9CH02a08yView
15Apple-FD-Discovery-F1-2003D5N/A95.1CH02a08yView
16Apple-FD-Discovery-F1-2003D10N/A29CH02a08yView
17Apple-MM-F15N/A61.9CH02a08.wView
18Apple-M432-2012LG5N/A57.4CH02a08.wView
19Apple-M27xM116-2016LG5N/A64.7CH02a08.wView
20Apple-MM-F15N/A81.8CH02a08.zView
21Apple-MM-F110N/A22.8CH02a08.yView
22Apple-M432-2012LG10N/A17.6CH02a08.yView
23Apple-JM7xS63-F1J5N/A64.6CH02a08View
24Apple-JM7xS63-F1S5N/A62.6CH02a08View
25Apple-JM7xS63-F1J10N/A9.9CH02a08View
26Apple-M432-2012LG5N/A68.5CH02a08.xView
27Pear-Ba-F1-2013Ba5N/A46.9CH02a08View
28Pear-Ba-F1-2013Ba10N/A8.2CH02a08View
29Pear-BD-F1-2015LG10N/A21CH02a08View
30Pear-Dangshansuli-F1-2015LG10N/A43.68CH02a08View
31Pear-integrated_consensus_map-IPCG-2017LG5N/A92.94CH02a08View
32Pear-integrated_consensus_map-IPCG-2017LG10N/A20.78CH02a08View