CH02a08, CH02a08 (genetic_marker) Malus x domestica

Marker Overview


Name	CH02a08
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	GA
PCR Condition	annealing temp 60 degree
Primer 1	CH02a08.primer 1: GAGGAGCTGAAGCAGCAGAG
Primer 2	CH02a08.primer 2: ATGCCAACAAAAGCATAGCC
Product Length	133-177
Polymorphism	P_ CH02a08
Publication	[view all]
Contact	C. Gessler Felicidad Fernandez-Fernandez R. Liebhard

Contact

Name

Details

C. Gessler

First name:	Cesare
Last name:	Gessler
Institution:	ETH Zurich
Address:	ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:	Switzerland
Email:	cesare.gessler@agrl.ethz.ch
Phone:	+41 44 632 38 71
Fax:	+41 (0) 632 11 08
Last update:	May 2002

Felicidad Fernandez-Fernandez

First name:	Felicidad
Last name:	Fernandez-Fernandez
Title:	Researcher
Institution:	East Malling Research
Address:	East Malling Research (EMR), New Road, East Malling, Kent ME19 6BJ, UK
Country:	United Kingdoms
Email:	felicidad.fernandez@emr.ac.uk
Fax:	+44 1732 849067
Last update:	Mar 2006

R. Liebhard

First name:	R.
Last name:	Liebhard
Institution:	Swiss Federal Institute of Technology
Address:	Swiss Federal Institute of Technology, Institute of Plant Science / Phytopathology, Universitätstrasse 2, 8092 Zurich, Switzerland
Country:	Switzerland

Publications


Year	Publication
2009	Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2002	Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015	Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004	Plant Breeding, 123(4):321
2012	Fernández-Fernández F, Antanaviciute L, van Dyk MM, Tobutt KR, Evans KM, Rees DJG, Dunwell JM, Sargent DJ. A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree genetics & genomes. 2012; 8(5):991-1002.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple Integrated map	5	N/A	85.1	CH02a08z	View
2	Apple-FD-F1-2006	D5	N/A	91.1	CH02a08z	View
3	Apple-FD-F1-2006	F5	N/A	55	CH02a08z	View
4	Apple-FD-F1-2006	F10	N/A	24.9	CH02a08y	View
5	Apple-FD-F1-2006	D10	N/A	23.2	CH02a08y	View
6	Apple Integrated map	10	N/A	19.9	CH02a08y	View
7	Apple-FD-Discovery-F1-2003	D5	N/A	95.1	CH02a08y	View
8	Apple-FD-Discovery-F1-2003	D10	N/A	29	CH02a08y	View
9	Apple-X3259X3263-F1	10	N/A	17.12	CH02a08	View
10	Apple-X5210X8402-F1-X5210	LG10	N/A	12.1	CH02a08	View
11	Apple-X5210X8402-F1-X8402	LG10	N/A	21.3	CH02a08	View
12	Pear-BD-F1-2014-genetic	LG10	N/A	142.1	CH02a08	View
13	Pear-Bartlett-F1-2007	Ba5	N/A	50.6	CH02a08	View
14	Pear-Bartlett-F1-2007	Ba10	N/A	15.6	CH02a08	View
15	Pear-La_France-F1-2007	La5	N/A	66	CH02a08	View
16	Pear-La_France-F1-2007	La10	N/A	13.9	CH02a08	View
17	Apple-MM-F1	5	N/A	61.9	CH02a08.w	View
18	Apple-M432-2012	LG5	N/A	57.4	CH02a08.w	View
19	Apple-M27xM116-2016	LG5	N/A	64.7	CH02a08.w	View
20	Apple-MM-F1	5	N/A	81.8	CH02a08.z	View
21	Apple-MM-F1	10	N/A	22.8	CH02a08.y	View
22	Apple-M432-2012	LG10	N/A	17.6	CH02a08.y	View
23	Apple-M432-2012	LG5	N/A	68.5	CH02a08.x	View
24	Pear-Ba-F1-2013	Ba5	N/A	46.9	CH02a08	View
25	Pear-Ba-F1-2013	Ba10	N/A	8.2	CH02a08	View
26	Pear-BD-F1-2015	LG10	N/A	21	CH02a08	View
27	Pear-Dangshansuli-F1-2015	LG10	N/A	43.68	CH02a08	View
28	Pear-integrated_consensus_map-IPCG-2017	LG5	N/A	92.94	CH02a08	View
29	Pear-integrated_consensus_map-IPCG-2017	LG10	N/A	20.78	CH02a08	View
30	Apple-JM7xS63-F1	J5	N/A	64.6	CH02a08	View
31	Apple-JM7xS63-F1	S5	N/A	62.6	CH02a08	View
32	Apple-JM7xS63-F1	J10	N/A	9.9	CH02a08	View

Alignments

Feature Name	Type	Location	Analysis
Chr10	chromosome	Chr10:9109468..9109615.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation