CH02c02b, CH02c02b (genetic_marker) Malus x domestica

Marker Overview
NameCH02c02b
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH02c02b.primer 1: TGCATGCATGGAAACGAC
Primer 2CH02c02b.primer 2: TGGAAAAAGTCACACTGCTCC
Product Length78-126
78–126
Max Length123 bp
PolymorphismP_ CH02c02b
Publication[view all]
ContactC. Gessler
Andreas Peil
Miyuki Kunihisa
Zhen Han
Publications
YearPublication
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH02c02b.primer 1Malus x domesticaprimer
primer 2CH02c02b.primer 2Malus x domesticaprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit mealinessqFRML.XX-ch4.1Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH02c02bCH02c02bMalus x domesticamarker_locus
CH02c02bCH02c02b-118.545Malus x domesticamarker_locus
CH02c02bCH02c02b-119.495Malus x domesticamarker_locus
CH02c02bCH02c02b-79.9Malus x domesticamarker_locus
CH02c02bCH02c02b-54.1Malus x domesticamarker_locus
CH02c02bCH02c02b-50Malus x domesticamarker_locus
CH02c02bCH02c02b-41.4Malus x domesticamarker_locus
CH02c02bCH02c02b-41.684Malus x domesticamarker_locus
CH02c02bCH02c02b-38.954Malus x domesticamarker_locus
CH02c02bCH02c02b-73.88Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map4N/A61CH02c02bView
2Pear-BH-F1Ho4N/A0CH02c02bView
3Apple-IM-F1-Mr5Mr5 LG 4N/A54.6CH02c02bView
4Pear-PM-F1-Moonglow4N/A51.1CH02c02bView
5Apple-OA-F1-OrinOR4N/A62.5CH02c02bView
6Apple-OA-F1-AkaneAK4N/A55.2CH02c02bView
7Apple-JGD-F1-FRRJ4N/A37.3CH02c02bView
8Apple-X3259X3263-F14N/A51.41CH02c02bView
9Apple-GDxJ-F1-2012LG4N/A50.9CH02c02bView
10Apple-JGD-F1-2014G4N/A36.6CH02c02bView
11Apple-RGTxGD-F1-2015RGT_4N/A58.79CH02c02bView
12Apple-RGTxGD-F1-2015GD_4N/A60.79CH02c02bView
13Apple-RGxPI6-F1LG4N/A56CH02c02bView
14Pear-BD-F1-2014-geneticLG4N/A0CH02c02bView
15Pear-Bartlett-F1-2007Ba4N/A553CH02c02bView
16Pear-La_France-F1-2007La4N/A68CH02c02bView
17Apple-FD-Discovery-F1-2003D4N/A79.2CH02c02bView
18Pear-Rcf-F1-femaleLG4N/A118.55CH02c02bView
19Pear-RM-F1-IntegratedLG4N/A119.5CH02c02bView
20Apple-JM7xS63-F1J4N/A79.9CH02c02bView
21Apple-JM7xS63-F1S4N/A54.1CH02c02bView
22Pear-Ba-F1-2013Ba4N/A50CH02c02bView
23Pear-BD-F1-2015LG4N/A41.4CH02c02bView
24Pear-Bayuehong-F1-2015LG4N/A41.68CH02c02bView
25Pear-Dangshansuli-F1-2015LG4N/A38.95CH02c02bView
26Pear-integrated_consensus_map-IPCG-2017LG4N/A73.88CH02c02bView
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple