|
Marker Overview
Name | CH02h07 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | GA |
PCR Condition | annealing temp 60 degree |
Primer 1 | CH02h07.primer 1: TGAGCTGACAAGTGTAAAATGC |
Primer 2 | CH02h07.primer 2: GCCGAACAATGTAAAGCTCG |
Product Length | 214-236 |
Polymorphism | P_ CH02h07 |
Publication | [view all] |
Contact | C. Gessler R. Liebhard
|
Publications
Year | Publication |
2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
|