|
Marker Overview
Name | CH03a03 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | GA |
PCR Condition | annealing temp 60 degree |
Primer 1 | CH03a03.primer 1: GTGGTGGTAATGACGAGAACCT |
Primer 2 | CH03a03.primer 2: AAGCAAAGTAGCCAAACTGCAT |
Product Length | 154-182 |
Polymorphism | P_ CH03a03 |
Publication | [view all] |
Contact | C. Gessler Zhen Han
|
Publications
Year | Publication |
2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
2013 | Lê Van A, Caffier V, Lasserre-Zuber P, Chauveau A, Brunel D, Le Cam B, Durel CE. Differential selection pressures exerted by host resistance quantitative trait loci on a pathogen population: a case study in an apple × Venturia inaequalis pathosystem. The New phytologist. 2013 Feb; 197(3):899-908. |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2015 | Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53. |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
|