CH03b01, CH03b01 (genetic_marker) Malus x domestica

Marker Overview
NameCH03b01
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH03b01.primer 1: ACAAGGTAACGTACAACTCTCTC
Primer 2CH03b01.primer 2: GTCACAAAACCGCCAGATG
Product Length160-180
PolymorphismP_ CH03b01
Publication[view all]
ContactC. Gessler
Zhen Han
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH03b01.primer 1Malus x domesticaprimer
primer 2CH03b01.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
resistance to Agrobacterium tumefaciensresistance to Agrobacterium tumefaciens-AgMalus sieboldiiheritable_phenotypic_marker


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH03b01.zCH03b01.zMalus x domesticamarker_locus
CH03b01.yCH03b01.yMalus x domesticamarker_locus
CH03b01CH03b01Malus x domesticamarker_locus
CH03b01CH03b01-37.2Malus x domesticamarker_locus
CH03b01CH03b01-26.6Malus x domesticamarker_locus
CH03b01CH03b01-49.1Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F12N/A23.6CH03b01.zView
2Apple-M432-2012LG2N/A16.5CH03b01.zView
3Apple-MM-F115N/A67.6CH03b01.yView
4Apple-M432-2012LG15N/A70.5CH03b01.yView
5Apple-JGD-F1-FRRG2N/A34.9CH03b01View
6Apple-JM7xS63-F1J2N/A37.2CH03b01View
7Apple-JM7xS63-F1S2N/A26.6CH03b01View
8Apple-JM7xS63-F1J15N/A49.1CH03b01View
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple