CH03g12, CH03g12 (genetic_marker) Malus x domestica

Marker Overview


Name	CH03g12
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	GA
PCR Condition	annealing temp 60 degree
Primer 1	CH03g12.primer 1: GCGCTGAAAAAGGTCAGTTT
Primer 2	CH03g12.primer 2: CAAGGATGCGCATGTATTTG
Product Length	154-200
Polymorphism	P_ CH03g12
Publication	[view all]
Contact	C. Gessler Cindy F. Verdu Fabrizio Costa

Contact

Name

Details

C. Gessler

First name:	Cesare
Last name:	Gessler
Institution:	ETH Zurich
Address:	ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:	Switzerland
Email:	cesare.gessler@agrl.ethz.ch
Phone:	+41 44 632 38 71
Fax:	+41 (0) 632 11 08
Last update:	May 2002

Cindy F. Verdu

First name:	Cindy
Last name:	Verdu
Title:	Researcher
Institution:	INRA
Address:	INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:	France
Email:	cindyverdu@gmail.com

Fabrizio Costa

First name:	Fabrizio
Last name:	Costa
Title:	Researcher
Institution:	Research and Innovation Centre, Foundation Edmund Mach
Address:	Via Mach 1, I-38010 San Michele all’Adige, Trento, Italy
Country:	Italy
Email:	fabrizio.costa@iasma.it
Phone:	390461615358
Fax:	390461650956

Publications


Year	Publication
2009	Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2002	Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014	Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2013	Di Guardo M, Tadiello A, Farneti B, Lorenz G, Masuero D, Vrhovsek U, Costa G, Velasco R, Costa F. A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.). PloS one. 2013; 8(10):e78004.
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015	Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004	Plant Breeding, 123(4):321
2014	Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-SG-F1	1	N/A	0	CH03g12-1_S	View
2	Apple-FD-F1-2006	F1	N/A	2.4	CH03g12z	View
3	Apple-FD-F1-2006	D1	N/A	4.2	CH03g12z	View
4	Apple Integrated map	1	N/A	1.5	CH03g12z	View
5	Apple-IM-F1-Mr5	Mr5 LG 1	N/A	22.5	CH03g12z	View
6	Apple-MAL0045_x_Idared-F1-Mfusca	LG1	N/A	0	CH03g12z	View
7	Apple-PF-F1-2012	ch1	N/A	2	CH03g12z	View
8	Pear-AN-F1	LG1	N/A	0	CH03g12z	View
9	Apple-X5210X8402-F1-Consensus	LG17	N/A	65.3	CH03g12z	View
10	Apple-FD-Discovery-F1-2003	D1	N/A	4.2	CH03g12z	View
11	Apple Integrated map	3	N/A	89.1	CH03g12y	View
12	Apple-FD-F1-2006	F3	N/A	65.7	CH03g12y	View
13	Apple-FD-F1-2006	D3b	N/A	61.3	CH03g12y	View
14	Apple-IM-F1-Idared	Ida LG 3	N/A	81.2	CH03g12y	View
15	Apple-IM-F1-Mr5	Mr5 LG 3	N/A	62.4	CH03g12y	View
16	Apple-MAL0045_x_Idared-F1-Mfusca	LG3	N/A	77.3	CH03g12y	View
17	Apple-PF-F1-2012	ch3	N/A	89	CH03g12y	View
18	Apple-RGTxGD-F1-2015	GD_3	N/A	71.75	CH03g12y	View
19	Apple-X5210X8402-F1-Consensus	LG3	N/A	76	CH03g12y	View
20	Apple-X5210X8402-F1-X5210	LG3	N/A	77.8	CH03g12y	View
21	Apple-FD-Discovery-F1-2003	D3	N/A	111.3	CH03g12y	View
22	Apple-X3259X3263-F1	3	N/A	76.91	CH03g12	View
23	Apple-X3259X3263-F1	1	N/A	0	CH03g12	View
24	Apple-RGTxGD-F1-2015	RGT_1	N/A	0	CH03g12	View
25	Apple-RGTxGD-F1-2015	GD_1	N/A	2.65	CH03g12	View
26	Pear-BD-F1-2014-genetic	LG3	N/A	10.6	CH03g12	View
27	Apple-MM-F1	1	N/A	0	CH03g12.z	View
28	Apple-M432-2012	LG1	N/A	0	CH03g12.z	View
29	Apple-MM-F1	3	N/A	66	CH03g12.y	View
30	Apple-M432-2012	LG3	N/A	64.8	CH03g12.y	View
31	Apple-X5210X8402-F1-X8402	LG17	N/A	64.8	Ch03g12_M	View
32	Pear-BD-F1-2015	LG3	N/A	111.9	CH03g12	View
33	Pear-Bayuehong-F1-2015	LG3	N/A	113.15	CH03g12	View
34	Pear-Dangshansuli-F1-2015	LG3	N/A	111.58	CH03g12	View
35	Pear-integrated_consensus_map-IPCG-2017	LG1	N/A	43.74	CH03g12	View
36	Pear-integrated_consensus_map-IPCG-2017	LG3	N/A	237.03	CH03g12	View
37	Apple-JM7xS63-F1	J1	N/A	14.8	CH03g12	View
38	Apple-JM7xS63-F1	J3	N/A	53.5	CH03g12	View
39	Apple-FjxPL-F1-2013	LG1	N/A	0.13	CH03G12_A	View
40	Apple-FjxPL-F1-2013	LG1	N/A	2.77	CH03G12_1	View
41	Apple-FjxPL-F1-2013	LG3	N/A	89.67	CH03G12_B	View