|
|
Marker Overview
| Name | CH04b10 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | GA |
|---|
| PCR Condition | annealing temp 60 degree |
|---|
| Primer 1 | CH04b10.primer 1: AGCAGACCAACGCATATCAA |
|---|
| Primer 2 | CH04b10.primer 2: TAATCTGTGCCGGTATGTGC |
|---|
| Product Length | 169-277 |
|---|
| Polymorphism | P_ CH04b10 |
|---|
| Publication | [view all] |
|---|
| Contact | C. Gessler
|
|---|
Publications
| Year | Publication |
|---|
| 2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
|
