CH04d07, CH04d07 (genetic_marker) Malus x domestica

Marker Overview
NameCH04d07
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH04d07.primer 1: TGTCCTCCAATCTTAACCCG
Primer 2CH04d07.primer 2: CACACAGACGACACATTCACC
Product Length119-142
PolymorphismP_ CH04d07
Publication[view all]
ContactC. Gessler
Miyuki Kunihisa
Zhen Han
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH04d07.primer 1Malus x domesticaprimer
primer 2CH04d07.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH04d07CH04d07Malus x domesticamarker_locus
CH04d07CH04d07-62.4Malus x domesticamarker_locus
CH04d07CH04d07-58.5Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F111N/A80.8CH04d07View
2Apple-OA-F1-OrinOR11N/A74.4CH04d07View
3Apple-OA-F1-AkaneAK11N/A73.5CH04d07View
4Apple-JGD-F1-BotcankerG11N/A24.1CH04d07View
5Apple-JGD-F1-FRRG11N/A47.9CH04d07View
6Apple-GDxJ-F1-2012LG11N/A19.4CH04d07View
7Apple-M432-2012LG11N/A88.8CH04d07View
8Apple-JGD-F1-2014J11N/A51.8CH04d07View
9Apple-M27xM116-2016LG11N/A76.1CH04d07View
10Apple-JM7xS63-F1J11N/A62.4CH04d07View
11Apple-JM7xS63-F1S11N/A58.5CH04d07View
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple