CH04f06, CH04f06 (genetic_marker) Malus x domestica

Marker Overview
NameCH04f06
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH04f06.primer 1: GGCTCAGAGTACTTGCAGAGG
Primer 2CH04f06.primer 2: ATCCTTAAGCGCTCTCCACA
Product Length159-179
PolymorphismP_ CH04f06
Publication[view all]
ContactC. Gessler
Andreas Peil
Miyuki Kunihisa
Zhen Han
R. Liebhard
Publications
YearPublication
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53.
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH04f06.primer 1Malus x domesticaprimer
primer 2CH04f06.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH04f06CH04f06Malus x domesticamarker_locus
CH04f06CH04f06-108.398Malus x domesticamarker_locus
CH04f06CH04f06-94.079Malus x domesticamarker_locus
CH04f06CH04f06-32Malus x domesticamarker_locus
CH04f06CH04f06-60.3Malus x domesticamarker_locus
CH04f06CH04f06-61.845Malus x domesticamarker_locus
CH04f06CH04f06-52.078Malus x domesticamarker_locus
CH04f06CH04f06-87.89Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map14N/A24.3CH04f06View
2Apple-FD-F1-2006F14N/A20CH04f06View
3Apple-FD-F1-2006D14aN/A10.4CH04f06View
4Apple-IM-F1-IdaredIda LG 14N/A25CH04f06View
5Apple-MM-F114N/A23.4CH04f06View
6Apple-OA-F1-AkaneAK14N/A3.7CH04f06View
7Apple-JGD-F1-BotcankerG14N/A58.4CH04f06View
8Apple-GDxJ-F1-2012LG14N/A68.3CH04f06View
9Apple-M432-2012LG14N/A0.1CH04f06View
10Apple-JGD-F1-2014G14N/A66.7CH04f06View
11Apple-JGxWSH-F1LG14N/A42.9CH04f06View
12Apple-WSH-F1LG14N/A43.8CH04f06View
13Pear-BD-F1-2014-geneticLG14N/A69.5CH04f06View
14Pear-Bartlett-F1-2007Ba14N/A32.3CH04f06View
15Pear-La_France-F1-2007La14N/A31.2CH04f06View
16Apple-FD-Discovery-F1-2003D14N/A11.4CH04f06View
17Pear-M-F1-maleLG14N/A108.4CH04f06View
18Pear-RM-F1-IntegratedLG14N/A94.08CH04f06View
19Pear-Ba-F1-2013Ba14N/A32CH04f06View
20Pear-BD-F1-2015LG14N/A60.3CH04f06View
21Pear-Bayuehong-F1-2015LG14N/A61.85CH04f06View
22Pear-Dangshansuli-F1-2015LG14N/A52.08CH04f06View
23Pear-integrated_consensus_map-IPCG-2017LG14N/A87.89CH04f06View
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple
R. Liebhard
First name:R.
Last name:Liebhard
Institution:Swiss Federal Institute of Technology
Address:Swiss Federal Institute of Technology, Institute of Plant Science / Phytopathology, Universitätstrasse 2, 8092 Zurich, Switzerland
Country:Switzerland