CH05a04, CH05a04 (genetic_marker) Malus x domestica

Marker Overview
NameCH05a04
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Condition94 °C for 5 min, 35x (94 °C for 60 s, 50 °C for 60 s, 72 °C for 60 s), 72°C for 10 min
annealing temp 60 degree
Primer 1CH05a04.primer 1: GAAGCGAATTTTGCACGAAT
Primer 2CH05a04.primer 2: GCTTTTGTTTCATTGAATCCCC
Product Length174-178
159-189
159–189
Max Length178
175 bp
PolymorphismP_ CH05a04
Publication[view all]
ContactC. Gessler
Miyuki Kunihisa
Zhen Han
Publications
YearPublication
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH05a04.primer 1Malus x domesticaprimer
primer 2CH05a04.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
phenolic compound contentqPHE.X5210X8402-LG16.F08.reynoutrinMalus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH05a04CH05a04Malus x domesticamarker_locus
CH05a04CH05a04-43.1Malus x domesticamarker_locus
CH05a04CH05a04-50.3Malus x domesticamarker_locus
CH05a04CH05a04-41.5Malus x domesticamarker_locus
CH05a04CH05a04-53.3Malus x domesticamarker_locus
CH05a04CH05a04-54.21Malus x domesticamarker_locus
CH05a04CH05a04-53.204Malus x domesticamarker_locus
CH05a04CH05a04-89.6Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006F16N/A51.4CH05a04View
2Apple-FD-F1-2006D16N/A46.6CH05a04View
3Apple-PF-F1-2004P16N/A28CH05a04View
4Apple Integrated map16N/A38.5CH05a04View
5Apple-MAL0045_x_Idared-F1-MfuscaLG16N/A43.8CH05a04View
6Pear-PM-F1-Moonglow16N/A23.13CH05a04View
7Apple-2000-2012-F1ch16N/A54CH05a04View
8Apple-PF-F1-2012ch16N/A36CH05a04View
9Apple-MM-F116N/A40.2CH05a04View
10Apple-OA-F1-OrinOR16N/A40.4CH05a04View
11Apple-OA-F1-AkaneAK16N/A41.3CH05a04View
12Apple-JGD-F1-FRRG16N/A17.3CH05a04View
13Apple-X3259X3263-F116N/A41.59CH05a04View
14Apple-GDxJ-F1-2012LG16.2N/A0CH05a04View
15Apple-M432-2012LG16N/A41.7CH05a04View
16Apple-RGTxGD-F1-2015RGT_16N/A35CH05a04View
17Apple-RGTxGD-F1-2015GD_16N/A40.08CH05a04View
18Apple-X5210X8402-F1-X5210LG16N/A47.3CH05a04View
19Apple-X5210X8402-F1-X8402LG16N/A69.9CH05a04View
20Apple-GDxBr-F1-2013LG16N/A27.03CH05a04View
21Pear-La_France-F1-2007La16N/A33.9CH05a04View
22Apple-FD-Discovery-F1-2003D16N/A50.2CH05a04View
23Apple-FjMp-F1LG16N/A43.1CH05a04View
24Apple-JM7xS63-F1J16N/A50.3CH05a04View
25Apple-JM7xS63-F1S16N/A41.5CH05a04View
26Pear-BD-F1-2015LG16N/A53.3CH05a04View
27Pear-Bayuehong-F1-2015LG16N/A54.21CH05a04View
28Pear-Dangshansuli-F1-2015LG16N/A53.2CH05a04View
29Pear-integrated_consensus_map-IPCG-2017LG16N/A89.6CH05a04View